Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Integrated Analysis of Population Genomics, Transcriptomics and Virulence Provides Novel Insights into Streptococcus pyogenes Pathogenesis [442 strains]

ABSTRACT: Purpose: We used GAS as a model bacterial pathogen to investigate the complex relationship between genome, transcriptome, and virulence in a large population of type emm28 strains recovered from humans over 26 years in geographically diverse locations. Methods: We chose a subset of isolates from the sequenced population of 2,101 emm28 strains that would approximately span the genetic variation present in the entire population. 442 emm28 strains grown as singleton cultures and harvested at one time point (early-stationary phase), and libraries were prepared using RNAtag-seq. Quality of the total RNA, rRNA-depleted RNA, and cDNA libraries was evaluated with RNA Nano, RNA Pico, and DNA high-sensitivity kits (Agilent Technologies), respectively, using an Agilent 2100 Bioanalyzer. For each sample, the cDNA library concentration was measured fluorometrically with Qubit™ dsDNA HS assay kits (Invitrogen). The cDNA libraries were diluted, pooled, and sequenced with an Illumina NextSeq 500 instrument.

ORGANISM(S): Streptococcus pyogenes

PROVIDER: GSE113055 | GEO | 2018/12/31

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Integrated Analysis of Population Genomics, Transcriptomics and Virulence Provides Novel Insights into Streptococcus pyogenes Pathogenesis [isogenic]

Project description:Purpose: We used GAS as a model bacterial pathogen to investigate the complex relationship between genome, transcriptome, and virulence in a large population of type emm28 strains recovered from humans over 26 years in geographically diverse locations. Methods: An isogenic mutant strain (MGAS27961-10T) with a 10-T homopolymeric tract was generated using allelic exchange. Primers were used to amplify a 2,690-bp fragment using genomic DNA of MGAS28085 an emm28 clinical isolate with the naturally occurring 10 “T” variant region. The resulting PCR product was cloned into suicide plasmid pBBL740 and transformed into the parental strain MGAS27961. RNA-seq was performed on the isogenic mutant strain MGAS27961-10T and parental strain (MGAS27961-9T). Quality of the total RNA, rRNA-depleted RNA, and cDNA libraries was evaluated with RNA Nano, RNA Pico, and DNA high-sensitivity kits (Agilent Technologies), respectively, using an Agilent 2100 Bioanalyzer. For each sample, the cDNA library concentration was measured fluorometrically with Qubit™ dsDNA HS assay kits (Invitrogen). The cDNA libraries were diluted, pooled, and sequenced with an Illumina NextSeq 500 instrument.

2018-12-31 | GSE113057 | GEO

Genetic heterogeneity of the Spy1336/R28 – Spy1337 virulence axis in Streptococcus pyogenes and effect on gene transcript levels and pathogenesis

Project description:Purpose: We used RNA-seq to analyze the transcriptomes of serotype M28 S. pyogenes deletion and SNP isogenic mutants strains. We discovered that changes in the number of T residues in a homopolymeric tract located upstream of the divergently transcribed Spy1336/R28 and Spy1337 genes affected global gene expression and virulence. We performed RNA-seq comparing isogenic mutants grown in vitro containing either 9 or 11Ts, and isogenic deletion mutants, deleted for gene Spy1337, and deleted for both, Spy1336 and Spy1337. Methods: We grew isogenic strains in rich media, and collected samples in triplicate at both mid-exponential (ME) and early stationary (ES) phase to perform RNA-seq analysis. Quality of the total RNA, rRNA-depleted RNA, and cDNA libraries was evaluated with RNA Nano, RNA Pico, and DNA high-sensitivity kits (Agilent Technologies, respectively, using an Agilent 2100 Bioanalyzer. For each sample, the cDNA library concentration was measured fluorometrically with Qubit™ dsDNA HS assay kits (Invitrogen). The cDNA libraries were diluted, pooled, and sequenced with an Illumina NextSeq 550 instrument

2020-04-01 | GSE145621 | GEO

New Pathogenesis Mechanisms and Translational Leads Identified by Multidimensional Analysis of Necrotizing Myositis in Primates

Project description:Purpose: We used dual RNA-seq to analyze the transcriptomes of serotype M1 S. pyogenes and host skeletal muscle recovered contemporaneously from infected nonhuman primates (NHPs). We identified genes important for necrotizing myositis, made isogenic deletion mutants and performed RNA-seq comparing one of those deletion mutant strains (dahA) grown in vitro and compared to its parental wild-type strain. Methods: We grew the emm1 reference strain MGAS2221 in rich media (growth in vitro), and collected samples in triplicate at both mid-exponential (ME), and early stationary (ES) phase, to perform RNA-seq analysis. In addition, three NHPs were injected in the quadriceps skeletal muscle with the same GAS strain, necropsied after 24 h, samples were excised in concentric sections (from 1, at the inoculation site, to 5 on the periphery), and analyzed by dual RNA-seq (growth in vivo). Mock-infected skeletal muscle tissue was collected as negative control. Isogenic mutant for dahA and its parental wild-type strain were grown under the same conditions. Quality of the total RNA, rRNA-depleted RNA, and cDNA libraries was evaluated with RNA Nano, RNA Pico, and DNA high-sensitivity kits (Agilent Technologies, respectively, using an Agilent 2100 Bioanalyzer. For each sample, the cDNA library concentration was measured fluorometrically with Qubit™ dsDNA HS assay kits (Invitrogen). The cDNA libraries were diluted, pooled, and sequenced with an Illumina NextSeq 550 instrument. .cDNA libraries for the dahA isogenic mutant and its parental wild-type strain, grown in vitro, were generated using Epicentre Scriptseq for bacteria and sequenced on Illumina NextSeq 500 instrument.

2020-02-26 | GSE144100 | GEO

Postnatal loss of Arx transcriptional activity in parvalbumin interneurons induces epilepsy-like network abnormalities

Project description:We report the use to RNA-sequencing to understand the role of postnatal Arx in the regulation of PV interneuron function. Total RNA extracted from control and Arx CKO male mice cells were submitted to the Next-Generation Sequencing Core of the University of Pennsylvania for cDNA amplification, library preparation, and sequencing using the Ovation RNA-seq v2 and Rapid DR Multiplexing kits (NuGEN). Whole mRNAseq libraries were prepared from 9 mice (5 control and 4 Arx CKO mice) using the SMARTer Ultra Low RNA Kit for Illumina Sequencing (Clontech, Cat#634936) according to manufacturer’s instructions. Standard methods to assess sample quality (Agilent Bioanalyzer, Kappa Biosystems Library Quantification kit, Qubit® Fluorometer) and measure cDNA concentration were used. A total of 1ng of amplified cDNA for each sample was used as input to build the sequencing libraries. Whole mRNAseq libraries from control and Arx CKO mice were quantified using Agilent Bioanalyzer DNA 7500 chips. Libraries were sequenced on the Illumina HiSeq 4000 2 × 100 (Illumina, San Diego, CA, USA) to generate 150bp paired end reads, yielding approximately 20-40 million reads per sample (~80 million reads per lane).

2020-09-09 | GSE157689 | GEO

Integrated Analysis of Population Genomics, Transcriptomics and Virulence Provides Novel Insights into Streptococcus pyogenes Pathogenesis [50 strains]

Project description:Purpose: We used GAS as a model bacterial pathogen to investigate the complex relationship between genome, transcriptome, and virulence in a large population of type emm28 strains recovered from humans over 26 years in geographically diverse locations. Methods: We chose a subset of isolates from the sequenced population of 2,101 emm28 strains that would approximately span the genetic variation present in the entire population. Fifty emm28 strains were grown in triplicate, harvested at two time points, mid-exponential (ME) and early-stationary (ES) phases of growth, and assayed in triplicate by RNA-seq. rRNA was depleted using the Ribo-Zero rRNA removal kit for Gram-positive bacteria (Illumina) and libraries were made using the ScriptSeq complete kit for bacteria (Illumina). The cDNA libraries were prepared with indexed reverse primers from the ScriptSeq Index PCR primers kit (Illumina), and purified with AMPureXP beads (Beckman Coulter).

2018-12-31 | GSE113056 | GEO

Ethnicity-specific transcriptomic variation in immune cells and correlation with disease activity in systemic lupus erythematosus

Project description:Participants were recruited from the California Lupus Epidemiology Study (CLUES). CLUES was approved by the Institutional Review Board of the University of California, San Francisco. Peripheral blood mononuclear cells were isolated from patient donors. Cells were isolated from peripheral blood utilizing magnetic beads (CD14+monocytes, B cells, CD4+T cells and NK cells) using EasySep protocol from STEM cell technologies on 120 patients. RNA and DNA were extracted using Qiagen column and quality was assessed on Agilent bioanalyzer. 1ng - 5ng of RNA was used with SmartSeqv2 protocol to get cDNA, followed by Illumina Nextera XT DNA library prep with input of 0.8ng cDNA and 15 cycles of PCR amplification. Both cDNA and DNA libraries qualities were controlled on Agilent bioanalyzer. Libraries were sequenced on HiSeq4000 PE150.

2021-03-04 | GSE164457 | GEO

Intrahepatic MAIT cell gene expression revealed by RNA-seq

Project description:RNA-seq was carried out as described by Simone Picelli et al. with minor modifications (Genome Res 2014;24:2033-40). Briefly, RNA was extracted from 5000 cells using a miRNeasy Micro Kits (Qiagen, German). RNA quality was assessed with an Agilent RNA 6000 Pico Kit (Agilent Technologies, cat#5067-1513, USA) on an Agilent 2100 Bioanalyzer. Each library was prepared from 2ng of total RNA. After reverse transcription, cDNA was amplified for 8 cycles followed by Agencourt AMPure XP purification, the quality of cDNA library was checked on an Agilent High Sensitivity DNA Kit (Agilent Technologies, cat#5067-4626). The cDNA was sheared to a 200-500 bp size range using the Covaris AFA system. The final library was carried out by using the NEB Next ULTRA II DNA Prep Kit, and their quality and size were checked using the Agilent High Sensitivity DNA Kit. The libraries were sequenced using a Hiseq 4000 system (Illumina, USA). At least million reads were obtained for each sample. For all RNA-seq reads, we cut the 5’ adaptor (AAGCAGTGGTATCAACGCAGAGTACAT GGG) using cutadapt (version 1.10) with the parameter –e 0.17, and then aligned to the hg19 genome using OSA (version 2.10.8). The aligned data were merged and count by Samtools (version 0.1.19+), and differentially expressed genes were found based on the edgeR with default parameters (Bioinformatics 2010;26:139-40). A gene was differentially expressed if (1) p < 0.05 (2) |log2(fold change)| > 1. For hierarchical clustering, the RPKM values of differentially expressed genes were log2-transformed and standardized. 1- Pearson correlation was then used as the distance for clustering. Differentially expressed genes were selected for GO analysis using R package clusterProfiler (Omics 2012;16:284-7).

2018-12-01 | GSE117627 | GEO

The Ino80 complex prevents invasion of euchromatin into silent chromatin

Project description:Purpose: We want to know whether Ino80C contribute to chromatin silencing at both euchromatin and heterochromatin Methods: All yeast cells were collected in exponential phase. Total RNA was extracted with phenol, digested with DNase and further purified by Trizol. Libraries of mRNA were prepared with Illumina TruSeq RNA Sample Prep Kits v2 or stranded RNA Sample Prep Kits. Libraries were sequenced on Illumina HiSeq 2000. ChIP DNA were purified through chromatin immunoprecipitation using an Arp5, H3K79me3 and H3K4me3 antibody. Libraries were prepared with a KAPA LTP kit and sequenced using the Illumina HiSeq 2000 platform. Conclusion: Our ChIP-Seq and mRNA-Seq data show that Ino80C contributes to silent chromatin in both euchromatin an heterochromatin

2015-01-22 | GSE52000 | GEO

RNA-seq of longitudinal human blood and nose swab samples from a controlled human infection experiment with SARS-CoV-2 virus

Project description:Controlled human infection experiments enable longitudinal profiling of immune responses to a pathogen. 36 healthy volunteers aged 18-29 years, with no evidence of previous infection or vaccination, were inoculated with SARS-CoV-2 virus and quarantined for 14 days. Blood samples for RNA sequencing were collected into PAXgene tubes before virus challenge, 6 hours after challenge, daily thereafter for 14 days and on day 28. Mid-turbinate nose swabs for RNA sequencing were collected before virus challenge, and on days 1, 3, 5, 7, 10 and 14 after challenge, preserved in RNAprotect. 18 of 36 participants developed a replicative SARS-CoV-2 infection as evidenced by consecutive PCR-positive swabs for the virus. For every participant, blood RNA from selected days were extracted and depleted for genomic DNA and globin mRNA, before cDNA libraries were constructed using KAPA RNA HyperPrep with RiboErase kits. Libraries were sequenced on the Illumina NovaSeq 6000 platform using NovaSeq 6000 S4 Reagent Kits (200 cycles). Nose swab RNA samples were extracted and depleted for genomic DNA before cDNA libraries were constructed using KAPA mRNA HyperPrep Kits. Libraries were sequenced on the Illumina NextSeq platform the using the NextSeq 500/550 High Output Kit (75 cycles).

2024-04-08 | E-MTAB-12993 | biostudies-arrayexpress

Transcriptome sequencing Analysis of hLFSCs with and without mechanical stress

Project description:Purpose:The goals of this study are to MS (mechanical stress) how to change the cellular pathway of hLFSCs (human ligament flavum stem cells). Methods: Extract hLFSCs from the ligament flavum of patients.Treat the cells with and without (in control)MS.Total RNA was extracted from cells with Tripure Isolation Reagent.Subsequently, RNA was purified through rRNA depletion and then subjected to cDNA synthesis and RNA amplification. Next, random hexamer primer cDNA libraries were evaluated using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA) and sequenced on Illumina Hiseq 4000 sequencing platform (Illumina, San Diego, California, USA) following the manufacturer’s instructions for paired-end 150 bp reads (Lifegenes, Shanghai, China).

2021-10-13 | GSE185614 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data