Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Integrated Analysis of Population Genomics, Transcriptomics and Virulence Provides Novel Insights into Streptococcus pyogenes Pathogenesis [isogenic]

ABSTRACT: Purpose: We used GAS as a model bacterial pathogen to investigate the complex relationship between genome, transcriptome, and virulence in a large population of type emm28 strains recovered from humans over 26 years in geographically diverse locations. Methods: An isogenic mutant strain (MGAS27961-10T) with a 10-T homopolymeric tract was generated using allelic exchange. Primers were used to amplify a 2,690-bp fragment using genomic DNA of MGAS28085 an emm28 clinical isolate with the naturally occurring 10 “T” variant region. The resulting PCR product was cloned into suicide plasmid pBBL740 and transformed into the parental strain MGAS27961. RNA-seq was performed on the isogenic mutant strain MGAS27961-10T and parental strain (MGAS27961-9T). Quality of the total RNA, rRNA-depleted RNA, and cDNA libraries was evaluated with RNA Nano, RNA Pico, and DNA high-sensitivity kits (Agilent Technologies), respectively, using an Agilent 2100 Bioanalyzer. For each sample, the cDNA library concentration was measured fluorometrically with Qubit™ dsDNA HS assay kits (Invitrogen). The cDNA libraries were diluted, pooled, and sequenced with an Illumina NextSeq 500 instrument.

ORGANISM(S): Streptococcus pyogenes

PROVIDER: GSE113057 | GEO | 2018/12/31

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Genetic heterogeneity of the Spy1336/R28 – Spy1337 virulence axis in Streptococcus pyogenes and effect on gene transcript levels and pathogenesis

Project description:Purpose: We used RNA-seq to analyze the transcriptomes of serotype M28 S. pyogenes deletion and SNP isogenic mutants strains. We discovered that changes in the number of T residues in a homopolymeric tract located upstream of the divergently transcribed Spy1336/R28 and Spy1337 genes affected global gene expression and virulence. We performed RNA-seq comparing isogenic mutants grown in vitro containing either 9 or 11Ts, and isogenic deletion mutants, deleted for gene Spy1337, and deleted for both, Spy1336 and Spy1337. Methods: We grew isogenic strains in rich media, and collected samples in triplicate at both mid-exponential (ME) and early stationary (ES) phase to perform RNA-seq analysis. Quality of the total RNA, rRNA-depleted RNA, and cDNA libraries was evaluated with RNA Nano, RNA Pico, and DNA high-sensitivity kits (Agilent Technologies, respectively, using an Agilent 2100 Bioanalyzer. For each sample, the cDNA library concentration was measured fluorometrically with Qubit™ dsDNA HS assay kits (Invitrogen). The cDNA libraries were diluted, pooled, and sequenced with an Illumina NextSeq 550 instrument

2020-04-01 | GSE145621 | GEO

New Pathogenesis Mechanisms and Translational Leads Identified by Multidimensional Analysis of Necrotizing Myositis in Primates

Project description:Purpose: We used dual RNA-seq to analyze the transcriptomes of serotype M1 S. pyogenes and host skeletal muscle recovered contemporaneously from infected nonhuman primates (NHPs). We identified genes important for necrotizing myositis, made isogenic deletion mutants and performed RNA-seq comparing one of those deletion mutant strains (dahA) grown in vitro and compared to its parental wild-type strain. Methods: We grew the emm1 reference strain MGAS2221 in rich media (growth in vitro), and collected samples in triplicate at both mid-exponential (ME), and early stationary (ES) phase, to perform RNA-seq analysis. In addition, three NHPs were injected in the quadriceps skeletal muscle with the same GAS strain, necropsied after 24 h, samples were excised in concentric sections (from 1, at the inoculation site, to 5 on the periphery), and analyzed by dual RNA-seq (growth in vivo). Mock-infected skeletal muscle tissue was collected as negative control. Isogenic mutant for dahA and its parental wild-type strain were grown under the same conditions. Quality of the total RNA, rRNA-depleted RNA, and cDNA libraries was evaluated with RNA Nano, RNA Pico, and DNA high-sensitivity kits (Agilent Technologies, respectively, using an Agilent 2100 Bioanalyzer. For each sample, the cDNA library concentration was measured fluorometrically with Qubit™ dsDNA HS assay kits (Invitrogen). The cDNA libraries were diluted, pooled, and sequenced with an Illumina NextSeq 550 instrument. .cDNA libraries for the dahA isogenic mutant and its parental wild-type strain, grown in vitro, were generated using Epicentre Scriptseq for bacteria and sequenced on Illumina NextSeq 500 instrument.

2020-02-26 | GSE144100 | GEO

Integrated Analysis of Population Genomics, Transcriptomics and Virulence Provides Novel Insights into Streptococcus pyogenes Pathogenesis [442 strains]

Project description:Purpose: We used GAS as a model bacterial pathogen to investigate the complex relationship between genome, transcriptome, and virulence in a large population of type emm28 strains recovered from humans over 26 years in geographically diverse locations. Methods: We chose a subset of isolates from the sequenced population of 2,101 emm28 strains that would approximately span the genetic variation present in the entire population. 442 emm28 strains grown as singleton cultures and harvested at one time point (early-stationary phase), and libraries were prepared using RNAtag-seq. Quality of the total RNA, rRNA-depleted RNA, and cDNA libraries was evaluated with RNA Nano, RNA Pico, and DNA high-sensitivity kits (Agilent Technologies), respectively, using an Agilent 2100 Bioanalyzer. For each sample, the cDNA library concentration was measured fluorometrically with Qubit™ dsDNA HS assay kits (Invitrogen). The cDNA libraries were diluted, pooled, and sequenced with an Illumina NextSeq 500 instrument.

2018-12-31 | GSE113055 | GEO

Regulatory Rewiring Confers Serotype-Specific Hyper-Virulence in the Human Pathogen Group A Streptococcus

Project description:We sequenced mRNA transcripts from three isogenic M3 serotype GAS strains, parental (MGAS10870), complement (10870::rocAM1), and deletion (10870?rocA). There were no significant changes between the parental and revertant strain. Comparison of the parental and complemented strain revealed several virulence factors were up-regulated in the parental strain where RocA function was diminished. We concluded that RocA, through direct or indirect mechanisms, is able to control numerous virulence genes and this lack of RocA regulation increases expression of virulence factors, which contributes to the hyper-virulent state of serotype M3 GAS. GAS strains were grown to mid-exponential phase, total RNA isolated, rRNA depleted, cDNA libraries synthesized, and libraries analyzed using Illumina MiSeq and CLC Genomics Workbench version 7.5.1 RNA-seq software.

2015-08-24 | E-GEOD-68277 | biostudies-arrayexpress

Postnatal loss of Arx transcriptional activity in parvalbumin interneurons induces epilepsy-like network abnormalities

Project description:We report the use to RNA-sequencing to understand the role of postnatal Arx in the regulation of PV interneuron function. Total RNA extracted from control and Arx CKO male mice cells were submitted to the Next-Generation Sequencing Core of the University of Pennsylvania for cDNA amplification, library preparation, and sequencing using the Ovation RNA-seq v2 and Rapid DR Multiplexing kits (NuGEN). Whole mRNAseq libraries were prepared from 9 mice (5 control and 4 Arx CKO mice) using the SMARTer Ultra Low RNA Kit for Illumina Sequencing (Clontech, Cat#634936) according to manufacturer’s instructions. Standard methods to assess sample quality (Agilent Bioanalyzer, Kappa Biosystems Library Quantification kit, Qubit® Fluorometer) and measure cDNA concentration were used. A total of 1ng of amplified cDNA for each sample was used as input to build the sequencing libraries. Whole mRNAseq libraries from control and Arx CKO mice were quantified using Agilent Bioanalyzer DNA 7500 chips. Libraries were sequenced on the Illumina HiSeq 4000 2 × 100 (Illumina, San Diego, CA, USA) to generate 150bp paired end reads, yielding approximately 20-40 million reads per sample (~80 million reads per lane).

2020-09-09 | GSE157689 | GEO

Transcriptome comparison of S. pyogenes strains MGAS2221 and 2221ΔrivRX

Project description:The rivR gene encodes a putative transcriptional regulator, while the rivX gene encodes a putative small regulatory RNA. To determine the RivRX regulon during exponential phase growth in THY broth we compared parental strain MGAS2221 with isogenic rivRX mutant strain 2221ΔrivRX.

2012-12-01 | GSE36646 | GEO

Intrahepatic MAIT cell gene expression revealed by RNA-seq

Project description:RNA-seq was carried out as described by Simone Picelli et al. with minor modifications (Genome Res 2014;24:2033-40). Briefly, RNA was extracted from 5000 cells using a miRNeasy Micro Kits (Qiagen, German). RNA quality was assessed with an Agilent RNA 6000 Pico Kit (Agilent Technologies, cat#5067-1513, USA) on an Agilent 2100 Bioanalyzer. Each library was prepared from 2ng of total RNA. After reverse transcription, cDNA was amplified for 8 cycles followed by Agencourt AMPure XP purification, the quality of cDNA library was checked on an Agilent High Sensitivity DNA Kit (Agilent Technologies, cat#5067-4626). The cDNA was sheared to a 200-500 bp size range using the Covaris AFA system. The final library was carried out by using the NEB Next ULTRA II DNA Prep Kit, and their quality and size were checked using the Agilent High Sensitivity DNA Kit. The libraries were sequenced using a Hiseq 4000 system (Illumina, USA). At least million reads were obtained for each sample. For all RNA-seq reads, we cut the 5’ adaptor (AAGCAGTGGTATCAACGCAGAGTACAT GGG) using cutadapt (version 1.10) with the parameter –e 0.17, and then aligned to the hg19 genome using OSA (version 2.10.8). The aligned data were merged and count by Samtools (version 0.1.19+), and differentially expressed genes were found based on the edgeR with default parameters (Bioinformatics 2010;26:139-40). A gene was differentially expressed if (1) p < 0.05 (2) |log2(fold change)| > 1. For hierarchical clustering, the RPKM values of differentially expressed genes were log2-transformed and standardized. 1- Pearson correlation was then used as the distance for clustering. Differentially expressed genes were selected for GO analysis using R package clusterProfiler (Omics 2012;16:284-7).

2018-12-01 | GSE117627 | GEO

Expression profiling of invasion associated molecules in head and neck cancer cells

Project description:Three isogenic HNC cell sublines with highly invasive properties were established. Invasion-associated genes were identified by comparison of transcriptomic profiles between HNC parental cell lines and the invasive sublines via Affymetrix cDNA microarrays. We used cDNA microarray to compare gene expression of invasion subline cells and parental cells in head and neck cancer.

2023-01-15 | GSE143689 | GEO

Network Modeling of Liver Metabolism to Predict Plasma Metabolite Changes During Short-Term Fasting in the Laboratory Rat: Liver Transcriptome Changes in Study 3

Project description:Purpose: The purpose of this study is to measure the changes in liver transcriptome in response to short-term fasting between 7 and 13 h where the rats were dosed with 2 ml/kg of saline vehicle at 0 h Methods: Total RNA was isolated from the liver, using TRIzol Reagent (Thermo Fisher Scientific, Waltham, MA) and the direct-zol RNA Mini Prep kit (Zymo Research, Irvine, CA). The isolated RNA samples were then submitted to the Vanderbilt University Medical Center VANTAGE Core (Nashville, TN) for RNA quality determination and sequencing. Total RNA quality was assessed using a 2100 Bioanalyzer (Agilent, Santa Clara, CA). At least 200 ng of DNase-treated total RNA with high RNA integrity was used to generate poly-A-enriched mRNA libraries, using KAPA Stranded mRNA sample kits with indexed adaptors (Roche, Indianapolis, IN). Library quality was assessed using the 2100 Bioanalyzer (Agilent), and libraries were quantitated using KAPA library Quantification kits (Roche). Pooled libraries were subjected to 75-bp paired-end sequencing according to the manufacturer’s protocol (Illumina HiSeq3000, San Diego, CA). Results: No genes were were found to be differentially expressed with a false discovery rate less than 0.1 Conclusions: There were no significant changes in liver gene expression between 7 and 13 h of fasting

2019-03-19 | GSE123987 | GEO

Network Modeling of Liver Metabolism to Predict Plasma Metabolite Changes During Short-Term Fasting in the Laboratory Rat: Liver Transcriptome Changes in Study 1

Project description:Purpose: The purpose of this study is to measure the changes in liver transcriptome in response to short-term fasting between 5 and 10 h where the rats were dosed with 6 ml/kg of polyethylene glycol vehicle at 0 h Methods: Total RNA was isolated from the liver, using TRIzol Reagent (Thermo Fisher Scientific, Waltham, MA) and the direct-zol RNA Mini Prep kit (Zymo Research, Irvine, CA). The isolated RNA samples were then submitted to the Vanderbilt University Medical Center VANTAGE Core (Nashville, TN) for RNA quality determination and sequencing. Total RNA quality was assessed using a 2100 Bioanalyzer (Agilent, Santa Clara, CA). At least 200 ng of DNase-treated total RNA with high RNA integrity was used to generate poly-A-enriched mRNA libraries, using KAPA Stranded mRNA sample kits with indexed adaptors (Roche, Indianapolis, IN). Library quality was assessed using the 2100 Bioanalyzer (Agilent), and libraries were quantitated using KAPA library Quantification kits (Roche). Pooled libraries were subjected to 75-bp single-end sequencing according to the manufacturer’s protocol (Illumina HiSeq3000, San Diego, CA). Results: No genes were were found to be differentially expressed with a false discovery rate less than 0.1 Conclusions: There were no significant changes in liver gene expression between 5 and 10 h of fasting

2019-03-19 | GSE123935 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data