Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Expression data from Arabidopsis seedlings expressing a synthetic oxygen sensor device

ABSTRACT: Gene expression was compared between 7-day old seedlings expressing two effector modules of an oxygen sensor device,consisting of the Saccharomyces cerevisiae Gal4 activation domain (AD) fused to the human HIF-CODD and the Gal4 DNA binding domain (BD) fused to the human pVHL, and seedlings expressing the previously described effector modules in addition to the sensory module constituted by the human PHD3 gene under control of constitutive promoters

ORGANISM(S): Arabidopsis thaliana

PROVIDER: GSE118364 | GEO | 2018/11/12

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

A Phase 1/2 Trial of TC-510 In Patients With Advanced Mesothelin-Expressing Cancer

Project description:TC-510 is a novel cell therapy that consists of autologous genetically engineered T cells expressing two synthetic constructs: first, a single-domain antibody that recognizes human Mesothelin, fused to the CD3-epsilon subunit which, upon expression, is incorporated into the endogenous T cell receptor (TCR) complex and second, a PD-1:CD28 switch receptor, which is expressed on the surface of the T cell, independently from the TCR. The PD-1:CD28 switch receptor comprises the PD-1 extracellular domain fused to the CD28 intracellular domain via a transmembrane domain. Thus, the switch is designed to produce a costimulatory signal upon engagement with PD-L1 on cancer cells.

| 2740481 | ecrin-mdr-crc

Prolyl-4-hydroxylase domain 3 (PHD3) is a critical terminator for cell survival of macrophages under stress conditions

Project description:On molecular level cells sense changes in oxygen availability through the prolyl-4-hydroxylase domain enzymes (PHDs), which regulate the protein stability of the α-subunit of the transcription factor hypoxia inducible factor (HIF). Especially PHD3 has been additionally associated with apoptotic cell death. We hypothesized that PHD3 plays a role in cell-fate decisions in macrophages. Therefore myeloid-specific PHD3 knock out mice (PHD3-/-) were created and analysed. PHD3-deficient bone marrow-derived macrophages (BMDM) showed no altered HIF-1alpha or HIF-2alpha stabilization or increased HIF target genes expression in normoxia or hypoxia. Macrophage M1 and M2-polarization was unchanged likewise. Compared to macrophages from wild type littermates PHD3-/- BMDM exhibited a significant reduction in TUNEL positive cells after serum withdrawal or treatment with staurosporine and s-nitroso-N-acetylpenicillamine (SNAP). Under the same conditions PHD3-/- BMDM also showed less Annexin V staining which is representative for membrane disruption and indicated a reduced early apoptosis. In an unbiased transcriptome screen we found that angiopoietin like protein 2 (Angptl2) expression was reduced in PHD3-/- BMDM under stress conditions. Addition of recombinant Angptl2 rescued the anti-apoptotic phenotype demonstrating that it is involved in the PHD3-mediated response towards apoptotic stimuli in macrophages.

2014-12-31 | GSE55693 | GEO

Transcription profiling by array of Arabidopsis overexpressing LBD16 and LBD18 to investigate downstream genes

Project description:Pro35SLBD16:GR or Pro35SLBD18:GR transgenic seedlings that overexpress LBD16 or LBD18 fused to glucocorticoidsteroid hormone binding domain(GR) under CaMV35S promoter were grown for 12 days under long-day conditions (16h light/ 8h dark).

2011-06-01 | E-MEXP-1400 | biostudies-arrayexpress

Single-cell analyses of regulatory network perturbations using enhancer-targeting TALEs suggest novel roles for PU.1 during haematopoietic specification

Project description:The aim of this study was to determine the genomic binding sites of an HA-tagged Transcription Activator-Like Effector (TALE) fused to a VP64 domain with a DNA binding domain designed to bind the sequence GGGCGCTTCCTGTTTTCTCA (found in the PU.1-14kb enhancer element in mouse and human genome), termed HA-T-VP64-PU.1-14, in the 416B mouse myeloid progenitor cell line.

2014-11-05 | GSE61189 | GEO

Expression data from Arabidopsis GR-REVOLUTA and KANADI1-GR transgenic seedlings

Project description:The REVOLUTA and KANADI1 transcription factors act in opposite directions to control polarity in Arabidopsis. By analyzing mRNA profiles following activation of REVOLUTA or KANADI1 proteins we identified genes regulated by both transcription factors, focusing on those regulated in opposite directions. To coordinate transcriptional responses for microarray analysis, we constructed transgenic seedlings with the REV or KAN1 transcription factor fused to a glucocorticoid receptor (GR) domain. The GR domain tethers the transcription factor in the cytoplasm, and treatment with dexamethasone (DEX) allows movement into the nucleus. Transgenic seedlings and wild-type controls were grown simultaneously in liquid culture, treated with dexamethasone for 0min, 30min, 60min, or 120min, and total RNA was extracted and hybridized to Affymetrix arrays. Treatment: Dexamethasone Biological replicates

2013-12-31 | E-GEOD-30702 | biostudies-arrayexpress

Prolyl hydroxylase PHD3 is essential for hypoxic regulation of neutrophilic inflammation in humans and mice

Project description:Neutrophils were isolated form peripheral blood of wildtype and Phd3 null mice, cultured for 4 hours in hypoxia (3% O2) and micro array analysis performed The aim of the present study is to identify the mechanism by which phd3 is required for the hypoxia mediated survival of neutrophils Murine peripheral blood neutrophils were isolated from wildtype and phd3 null mice, cultured for 4 hours in hypoxia (3% O2) and micro array analysis performed

2011-02-08 | E-GEOD-26023 | biostudies-arrayexpress

CBX2.1/PRC1 regulates the targeting of the Histone H3.3 chaperone DAXX to the genome (ChIP-Seq)

Project description:We report the genome-wide occupancy of exogenous DAXX (Myc-tagged), exogenous full length CBX2.1 (tagged with GAL4 DNA binding domain) and exogenous splice variant CBX2.2 (tagged with GAL4 DNA binding domain) in transiently transfected HEK293 cells. We observe that CBX2.1 but not CBX2.2 can efficiently target DAXX to chromatin.

2020-05-12 | GSE107348 | GEO

Transcription profiling of liver from mice with constitutively active Hypoxia Inducible Factor (HIF-1a and HIF-2a) or inactivated von Hippel-Lindau tumor suppressor gene product (pVHL)

Project description:The effects of constitutively active Hypoxia Inducible Factor (HIF) and inactivated von Hippel-Lindau tumor suppressor gene product (pVHL) were examined in a mouse model. Conditionally expressed, constitutively active HIF-1a and HIF-2a were compared with inactivated pVHL.

2006-09-21 | E-MEXP-856 | biostudies-arrayexpress

Human ccRCC cell line 786-O with PHD3 knockdown LC-MS/MS

Project description:Appreciating the pseudohypoxic signalling in ccRCC cells we decided to look into the effects of an established hypoxia-related enzyme, namely PHD3, in ccRCC development. Interestingly, these cells express PHD3 in unusually high amounts, a phenomena yet unexplained. We were interested in determining how ccRCC cells expressing elevated levels of PHD3 would respond to its knockdown. It has been shown that PHD3 has many other functions in addition to its given role as regulating HIF-1 by targeting it for proteosomal degradation. Motivated by these varied roles of PHD3 we decided to look for indications of a systemic-level changes that might be governed by PHD3 in ccRCC. To this end we chose a discovery proteomics –approach to see how ccRCC cells would respond on proteome level to PHD3 depletion.

2017-07-10 | PXD005453 | Pride

SHY2-dose dependent transcriptome analysis

Project description:To identify genes involved in auxin respone depending on SHY2 level, we profiled the transcriptome of plants induced differential level of SHY2 by 0.1 nM or 1 μM dexamethosone treatment. For this we used the roots of seedlings expressing non-degradable version of the Aux/IAA3 (shy2-1) fused to the glucocorticoid receptor domain (shy2-1:GR) under the root hair cell specific EXPA7 promoter. The nuclear translocation of the non-degradable Aux/IAA, specifically in root hair cells, that acts as a biomodal switch in regulation of target genes transcription both positively and negatively.

2024-08-30 | GSE130611 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data