Expression Profiling of Dll1 mutant mouse lines on different genetic background
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
PROVIDER: GSE11867 | GEO | 2009/01/01
SECONDARY ACCESSION(S): PRJNA105675
REPOSITORIES: GEO
Similar Datasets
Project description:The evolutionarily conserved Delta-Notch cell-cell signal-transduction pathway regulates the determination of various cell fates, which are important for the morphogenesis and development of numerous organs and tissues in many vertebrates and invertebrates. The Dll1 gene was mutated by homologous recombination in embryonic stem cells such that amino acids 2-116 were replaced with an in-frame fusion of the lacZ gene of E.coli. Mouse Dll1 genomic clones were isolated from a strain 129/SvPas library. The replacement vector was constructed by inserting a 4 kb ClaI/XhoI fragment, which encodes a part of the beta-galactosidase gene followed by the PGK-neo cassette, and a 2.6 kb XhoI/EcoRI fragment as the 3M-bM-^@M-^Y homologous region of the replacement vector into pKS+. This vector was linearized with SalI and ClaI, and a 4.1 kb SalI/NcoI as the 5M-bM-^@M-^Y homologous region plus an NcoI/ClaI fragment (800 bp) completing the b-galactosidase gene, were inserted, resulting in the complete replacement vector. This vector was linearized with SalI and electroporated in R1 embryonic stem cells. Correctly targeted clones were identified and verified by Southern blot analysis using external probes from the 3M-bM-^@M-^Y and 5M-bM-^@M-^Y region of the targeted area, and were injected into C57BL/6J embryo to obtain germline transmission. The two analysed Dll1 mutant mouse lines carry the same mutation but are on different genetic background: 1. Heterozygous F1-animals were backcrossed several times to the 129SV/J wild type; 2. Heterozygous F1-animals were outcrossed 11 generation to C3HeB/FeJ wild type Four organs (liver, spleen, thymus, brain) of two Dll1 mutant mouse lines on different genetic background carrying the same mutation were analysed by cDNA microarray technology. Experiment include 4-5 biological replicates for reference (wildtype) and mutant animals. Up to 4 technical replicates for each mutant mouse were performed. As reference pooled RNA was used. 50% of the chip hybridisations are dye sway experiments.
2009-01-01 | E-GEOD-11867 | biostudies-arrayexpress
Project description:Repressor-activator protein 1 (scRap1) is the major binding activity at Saccharomyces cerevisiae telomeres, with roles in telomere length regulation and establishment of subtelomeric silencing by recruiting the Sir proteins. scRap1 also acts as a transcription factor controlling the expression of ribosomal proteins and glycolytic enzymes. A homolog of scRap1 exist in mammals, Rap1 (also known as Terf2ip), however, its roles in telomere biology and transcriptional regulation are largely unknown. We have employed microarrays to obtain gene expression signatures related to Rap1-deleted mice when compared to the wild-type. Construction of the Rap1 targeting vector: The strategy for disrupting the Rap1 locus was designed to conditionallty delete exon 3 (E3) through a Cre-mediated excision. Deletion of E3 leads to the removal of coding sequences encoding for the RCT domain and the NLS sequence, as well as the whole 3’UTR region and poly-adenylation signal (Fig.1A,B). Deletion of E3 was expected to destabilize the Rap1 transcript and thereby to prevent translation of any truncated RAP1 protein. The targeting vector contains homology regions isogenic with the ES cell line used (129Sv/Pas). The short homology region (SA) harbors a 2.4 kb DNA fragment encompassing exon 2 (E2) and intron 2 (Fig. 1A). The long homology region (LA) is a 5.6 kb DNA fragment downstream the end of E3 (Fig. 1A). The central part contains E3 flanked by two loxP sites and a positive selection neomycin gene (PGK-Neo) flanked by two Frt sites (Fig. 1A). At the 3’-end of the LA a Diphteria Toxin (DTA) selection marker was cloned (Fig. 1A). The vector contains a unique NruI linearization site. The targeting vector was quality controlled by sequencing of the coding exons, the junctions between the homology arms and the selection cassettes, the selection cassettes and the junctions between the homology arms and the plasmid backbone. The analysis of the sequencing results showed no polymorphis between the C57BL/6 and 129Sv/Pas genetic background within the isolated Rap1 sequences. The sequence of the primers used for the PCR amplification of the different targeting vector parts and the details of the cloning steps are available upon request. The construction of the targeting vector was performed by genOway (www.genoway.com; Lyon, France). Generation of conditional Rap1 knockout mice 129Sv/Pas ES cells were transfected with 40 µg of linearized plasmid. Positive selection was started 48 hours after electroporation by addition of 200 µg/ML G418. Approximately 230 positive resistant clones were isolated and amplified. They were PCR screened for homologous recombination first at the 5’ end of the Rap1 locus. The 6 positive identified 5’ targeted ES cells were further investigated by PCR amplification over the 3’ long homology arm to amplify the region of the targeted locus containing the distal loxP site. The direct sequencing of the PCR products amplified from the 6 ES clones revealed that 3 of them contained the distal loxP site. The recombinant clones identified by PCR were further verified by Southern blot analysis of AflII and PciI restricted genomic DNA using a 5’-internal and a 3’-external probes, respectively (data not shown). The Southern blots confirmed the correct homologous integration over the 5’ and the 3’ homology arm and the absence of any additional randomly integrated copies of the targeting vector. Chimeric mice were generated by microinjection of three independently targeted ES clones into C57BL/6J host blastocyst. The resulting offspring showed a high level of chimerism as shown by coat color, and were mated to C57BL/6J mice to assess germ line transmission. The resulting heterozygous Rap1+/flox-Neo mice were then bred to transgenic mice expressing the Flpe recombinase (Rodriguez et al., 2000) to induce excision of the Neo marker. The Rap1+/flox heterozygous mice were then intercrossed to generate Rap1flox/flox, and Rap1+/flox mice. Homozygous Rap1flox/flox mice were crossed with transgenic mice expressing the Cre recombinase under the control of the keratine 5 promoter (Tarutani et al., 1997) (Fig. 5A). Heterozygous Rap1+/D K5-Cre were crossed either to Rap1flox/flox or Rap1+/flox to generate Rap1Δ/Δ K5-Cre. The removal of exon 3 by Cre-mediated recombination was confirmed by PCR analysis using primers F and R (Fig. 1A,C and Fig. 5A). Amplification of the wild type, flox and knockout alleles renders a 3.2 kb, 3.3 kb and 0.5 kb fragments, respectively. The breeding to the F1 generation and characterization of heterozygous Rap1+/flox-Neo F1 animals was performed by geneOway (www.genoway.com; Lyon, France). All mice were generated and maintained at the Spanish National Cancer Centre (CNIO) under specific pathogen-free conditions in accordance with the recommendation of the Federation of European Laboratory Animal Science Associations.
2010-07-10 | E-GEOD-19011 | biostudies-arrayexpress
Project description:Objective DLL1 is a mammalian Notch ligand with essential functions during embryonic development. We tagged endogenous DLL1 in one homologous recombination step such that AcGFP-HA tagged DLL1 could be converted by Cre-mediated site-specific recombination into StrepFlag tagged DLL1. We anticipated that this should allow us to visualise DLL1 in living cells as well as allow for sorting and enrichment of DLL1-expressing cells and efficient purification of DLL1 protein complex. Results We generated constructs to express a DLL1 variant that carried C-terminal in frame an AcGFPHA tag flanked by loxP sites followed by a StrepFlag tag out of frame. Cre-mediated recombination removed AcGFP-HA and added StrepFlag in frame to DLL1. The AcGFPHAstopStrepFlag tag was added to the Dll1 cDNA to allow for tests in cultured cells in vitro and was introduced into endogenous DLL1 in mice using ES cells modified by homologous recombination. Tagged DLL1 protein was detected by antibodies against GFP and HA or Flag, respectively, both in CHO cell and embryo lysates. In CHO cells the AcGFP protein fused to DLL1 was functional. In vivo AcGFP expression was below the level of detection by direct fluorescence. However, the StrepFlag tag allowed us to specifically purify DLL1 complexes from embryo lysates. Homozygous mice expressing AcGFPHA or StrepFlag-tagged DLL1 revealed a vertebral column phenotype reminiscent of disturbances in AP polarity during somitogenesis, a process most sensitive to reduced DLL1 function. Thus, even small C-terminal tags can impinge on sensitive developmental processes requiring DLL1 activity.
2021-11-03 | PXD024680 | Pride
Project description:Transcription profiling of Prss16 Tssp can be used to evidentiate further endopeptidase genes candidate to self-peptide generation in the thymus. All mice studied were C57BL/6 background and KO (knockout) Prss16-deficient mice were previously obtained by homologous recombination in embryonic stem (ES) cells of a targeting vector carrying Neo resistance gene marker, which has allowed replacement of exons 8 to 12 of the Prss16 gene in KO mice (data not shown). Briefly, one properly targeted ES clone was injected into BALB/c blastocysts to generate chimeric mice. Chimeric males were mated to C57BL/6 females to generate heterozygous pups in which the Neo selection cassette had been excised. Mice heterozygous for the mutation,originally on mixed 129/Sv x C57BL/6 genetic background, were intercrossed to generate homozygous mutants (Prss16-/-), WT (Prss16+/+) and heterozygousmutants (Prss16+/-) littermates. Genotype analysis was performed on genomic DNA from tail biopsies using PCR primers F (5M-^R GCCTGACACAAGTCGCCATAGG 3M-^R),R1 (5M-^R CCAGTTCCTCCCTCAGCACAG 3M-^R) and R2 (5M-^R CCAGTAAGAGTGAGGTCCAGAC 3M-^R). The WT Prss16 allele was visualized as a 600 bp fragment using the F-R1 pair ofprimers, whereas the mutant allele was visualized as a 447 bp fragment using the F-R2 pair of primers. Absence of mRNA expression in the thymus of Prss16-/- mice was confirmed by northern-blot using a cDNA probe (data not shown). The Prss16 deficient mice were crossed onto a C57BL/6 background for eightgenerations and the thymi of the resulting mice were used for analysis.
2010-08-31 | E-MEXP-2829 | biostudies-arrayexpress
Project description:We report the effect on genome-wide gene expression after deletion of an enhancer region downstream of Sox2 in F1 ES cells. The Sox2 transcription factor must be robustly transcribed in embryonic stem (ES) cells to maintain pluripotency. Reporter assays reveal novel enhancers, including two enhancers over 100 kb downstream (SRR107 and SRR111) which, through the formation of chromatin loops, localise to the Sox2 promoter in ES cells. Using CRISPR/Cas9 we deleted a region containing these two enhancers, which we term the Sox2 control region (SCR). This deletion revealed that the SCR is required for Sox2 transcription in ES cells. Furthermore, homozygous deletion of this distal Sox2 control region (SCR) caused significant reduction in Sox2 mRNA and protein levels, loss of ES cell colony morphology, genome-wide changes in gene expression and impaired neuroectodermal formation upon spontaneous differentiation to embryoid bodies. Together these data identify a distal control region essential for Sox2 transcription in ES cells. Examination of PolA+ RNA after heterozygous and homozygous enhancer deletion in F1 ES cells (M. musculus129 x M. castaneus).
2014-11-19 | E-GEOD-58339 | biostudies-arrayexpress
Project description:Production of viable and fertile mice have been reported by nuclear replacement, however, the reasons behind the frequent deformations among foetuses and progeny are not well understood. Activation and in vitro culture methods are also important. Origin of the nuclear donor cells affects success rates, and their survival in culture varies. It has been reported that offspring of nuclear replacement parental mice were normal and fertile. All epigenetic problems in the parents seem to be erased when cell nuclei go through the germ line. cDNA microarray analysis compared expression patterns of Dll1 ko versus Dll1 ko NT (NT = nuclear transfer) and wt versus wt NT of liver and spleen. The aim of this study was analysis of possible epigenetic effects by cloning in the offspring of the 3rd generation. If the 3rd generation cloned animals are indeed phenotypically equivalent to conventional transgenic mouse models then this would open the possibility to develop novel techniques of genetic engineering based on somatic gene targeting and nuclear replacement. four male animals of each cohort (Dll1 conventional transgenic mouse, Dll1 nuclear transfer mouse, wildtype, wildtye nuclear transfer mouse). Two technical replicates including a colour flip experiment. For each analysed organ (liver, spleen) eight experiments including four biological replicates. As reference RNA pools were used
2011-01-01 | E-GEOD-20560 | biostudies-arrayexpress
Project description:miR26b KO mice were generated by Laser assisted (XY-Clone Hamilton Thorne) injection of R1/E(129/Sv) cells into 8-cell stage C57Bl/6NCrl embryos.Chimaeras were crossed to C57Bl/6NCrl mice and their offspring was screened for germline transmission. Embryo donor and recipient mice: C57BL/6NCrl, Crl:CD1(ICR). We induced homologous recombination in embryonic stem (ES) cells using a construct containing 2.0 kb of gDNA, including exon 2,3 and 4, as also part of intron 4-5, a Neo Cassette was inserted in between Frt sites. 160 bp of gDNA, including miR26b was flanked by loxP sites (floxed). The construct was finished by introducing a 5.6 kb fragment of gDNA serving as 3’ recombination arm.A correctly targeted ES cell clones were injected into blastocysts to produce a chimeric mice which transmitted the modified allele through the germ line. A male heterozygous for the targeted allele was bred with a female expressing ubiquitous Flippase (Flp) transgene to ultimately produce animals that had deleted the Neo cassette, preserving the loxP sites flanking exon miR26b.
2020-03-26 | GSE147519 | GEO
Project description:Inserting large DNA payloads (>5 kb) into specific genomic sites of mammalian cells remains challenging. We have merged the strengths of different classes of site-specific recombinases and combine these with CRISPR/Cas9-mediated homologous recombination to develop a strategy for targeted DNA integration of huge constructs (e.g. >170 kb) as well as stringent site-specific replacement of genomic fragments >50 kb in size in human induced pluripotent stem cells. In order to validate the genome integrity of the payloads integrated by STRAIGHT-IN (Serine and Tyrosine Recombinase Assisted Integration of Genes for High-Throughput INvestigation), we performed next generation sequencing (i.e. whole genome and targeted capture sequencing) on the resulting genetically modified cell lines. We have deposited here the raw data.
2022-09-22 | E-MTAB-11971 | biostudies-arrayexpress
Project description:Production of viable and fertile mice have been reported by nuclear replacement, however, the reasons behind the frequent deformations among foetuses and progeny are not well understood. Activation and in vitro culture methods are also important. Origin of the nuclear donor cells affects success rates, and their survival in culture varies. It has been reported that offspring of nuclear replacement parental mice were normal and fertile. All epigenetic problems in the parents seem to be erased when cell nuclei go through the germ line. cDNA microarray analysis compared expression patterns of Dll1 ko versus Dll1 ko NT (NT = nuclear transfer) and wt versus wt NT of liver and spleen. The aim of this study was analysis of possible epigenetic effects by cloning in the offspring of the 3rd generation. If the 3rd generation cloned animals are indeed phenotypically equivalent to conventional transgenic mouse models then this would open the possibility to develop novel techniques of genetic engineering based on somatic gene targeting and nuclear replacement.
2011-01-01 | GSE20560 | GEO
Project description:We report 12 individuals from ten unrelated families with epilepsy, learning difficulties, intellectual disability, and neurobehavioral abnormalities, who segregated a microdeletion distally adjacent to the Williams-Beuren syndrome region. In six families, a recurrent ~ 1.1 Mb deletion likely resulted from nonallelic homologous recombination between flanking large complex low-copy repeats. Three smaller sized microdeletions (~ 180-500 kb) enabled us to narrow the critical region to one gene, HIP1, encoding Huntington interacting protein 1. genomic DNA from blood was used to analyse 12 samples with control sample using custom made NimbleGen 12x135K microarrays for chr7 region.
2010-08-28 | E-GEOD-23834 | biostudies-arrayexpress