Littorina saxatilis Expression study with NimbleGen 090824_L_saxatilis_expr_HX12
Ontology highlight
ABSTRACT:
ORGANISM(S): Littorina saxatilis
PROVIDER: GSE120697 | GEO | 2018/10/02
REPOSITORIES: GEO
Similar Datasets
Project description:Natural selection often produces parallel phenotypic changes in response to a similar adaptive challenge. However, the extent to which parallel gene expression differences and genomic divergence underlie parallel phenotypic traits and whether they are decoupled or not remains largely unexplored. We performed a population genomic study of parallel local adaptation among replicate ecotype pairs of the rough periwinkle (Littorina saxatilis) at a regional geographical scale (NW Spain). We show that phenotypic divergence followed complex evolutionary paths, affecting multiple loci, and including the parallel recruitment of the same genes as well as completely different genes in distinct ecotype pairs. The majority of divergent genes were divergent either for gene expression or coding sequence, but not for both simultaneously, providing evidence for a decoupled evolution among regulatory and coding regions. Overall, our findings suggest that gene expression and coding sequences may evolve independently as a result of being distinctly targeted by evolutionary constraints, and that divergent selection significantly contributed to the process of molecular differentiation among ecotype pairs.
2018-10-02 | GSE120698 | GEO
Project description:Developmental mechanisms play an important role in determining the costs, limits, and evolutionary consequences of phenotypic plasticity. One issue central to these claims is the metaphor of developmental “decoupling,” where alternate morphs result from evolutionarily independent developmental pathways. We test this assumption through a microarray study that explores differences in gene expression between alternate morphs relative to differences between sexes, a classic example of developmental decoupling. We then examine whether morph-biased genes are less conserved, relative to morph-shared genes, as predicted if developmental decoupling relaxes pleiotropic constraints on divergence. We focus on the developing horns and brains of two species of horned beetles with spectacular sexual- and morph-dimorphism in the expression of horns and fighting behavior. We find that patterns of gene expression were as divergent between morphs as they were between sexes. However, overall patterns of gene expression were also highly correlated across morphs and sexes. Morph-biased genes were more evolutionarily divergent, suggesting a role of relaxed pleiotropic constraints or relaxed selection. Together these results suggest that alternate morphs are somewhat developmentally decoupled, and that this decoupling has significant evolutionary consequences. However, alternative morphs may not be as developmentally decoupled as sometimes assumed and such hypotheses of development should be revisited and refined.
2010-09-15 | GSE23425 | GEO
Project description:Background: Array comparative genomic hybridization (aCGH) is commonly used to screen different types of genetic variation in humans and model species. Here, we performed aCGH using an oligonucleotide gene-expression array for a non-model species, the intertidal snail Littorina saxatilis. First, we tested what types of genetic variation can be detected by this method using direct re-sequencing and comparison to the Littorina genome draft. Secondly, we performed a genome-wide comparison of four closely related Littorina species: L. fabalis, L. compressa, L. arcana and L. saxatilis and of populations of L. saxatilis found in Spain, Britain and Sweden. Finally, we tested whether we could identify genetic variation underlying M-bM-^@M-^\CrabM-bM-^@M-^] and M-bM-^@M-^\WaveM-bM-^@M-^] ecotypes of L. saxatilis. Results: We could reliably detect copy number variations, deletions and high sequence divergence (i.e. above 3%), but not single nucleotide polymorphisms. The overall hybridization pattern and number of significantly diverged genes were in close agreement with earlier phylogenetic reconstructions based on single genes. The trichotomy of L. arcana, L. compressa and L. saxatilis could not be resolved and we argue that these divergence events have occurred recently and very close in time. We found evidence for high levels of segmental duplication in the Littorina genome (10% of the transcripts represented on the array and up to 23% of the analyzed genomic fragments); duplicated genes and regions were mostly the same in all analyzed species. Finally, this method discriminated geographically distant populations of L. saxatilis, but we did not detect any significant genome divergence associated with ecotypes of L. saxatilis. Conclusions: The present study provides new information on the sensitivity and the potential use of oligonucleotide arrays for genotyping of non-model organisms. Applying this method to Littorina species yields insights into genome evolution following the recent species radiation and supports earlier single-gene based phylogenies. Genetic differentiation of L. saxatilis ecotypes was not detected in this study, despite pronounced innate phenotypic differences. The reason may be that these differences are due to single-nucleotide polymorphisms. Genomic DNA samples of L. fabalis, L. compressa, L. arcana and 3 geographic populations x 2 ecotypes of L. saxatilis (n=4 per group) have been hybridized to a transcriptomic oligoarray.
2014-07-29 | E-GEOD-59825 | biostudies-arrayexpress
Project description:Developmental mechanisms play an important role in determining the costs, limits, and evolutionary consequences of phenotypic plasticity. One issue central to these claims is the metaphor of developmental “decoupling,” where alternate morphs result from evolutionarily independent developmental pathways. We test this assumption through a microarray study that explores differences in gene expression between alternate morphs relative to differences between sexes, a classic example of developmental decoupling. We then examine whether morph-biased genes are less conserved, relative to morph-shared genes, as predicted if developmental decoupling relaxes pleiotropic constraints on divergence. We focus on the developing horns and brains of two species of horned beetles with spectacular sexual- and morph-dimorphism in the expression of horns and fighting behavior. We find that patterns of gene expression were as divergent between morphs as they were between sexes. However, overall patterns of gene expression were also highly correlated across morphs and sexes. Morph-biased genes were more evolutionarily divergent, suggesting a role of relaxed pleiotropic constraints or relaxed selection. Together these results suggest that alternate morphs are somewhat developmentally decoupled, and that this decoupling has significant evolutionary consequences. However, alternative morphs may not be as developmentally decoupled as sometimes assumed and such hypotheses of development should be revisited and refined. We compared gene expression in three focal epidermal tissues (head, prothorax, legs) relative to a "control" tissue (dorsal abdominal epidermis) without any outgrowths. We also surveyed gene expression in the brain, relative to ganglionic neural tissue. We compared such patterns of gene expression between two male morphs (horned, fighter and hornless, sneaker males) and between males and females. We focused our array analyses (N = 48 arrays) on Onthophagus taurus (the species for which the array was designed), but also ran 19 arrays on thoracic tissue of Onthophagus nigriventris, a species which expresses thoracic horns as adults (O. taurus expresses head horns). Finally, we included a small subset of arrays (N = 4) directly hybridizing head epidermis tissue of O. taurus male morphs to validate our overall estimates of morph-biased expression. For more detail, refer to Snell-Rood et al. 2010, Evolution.
2010-09-15 | E-GEOD-23425 | biostudies-arrayexpress
Project description:Background: Array comparative genomic hybridization (aCGH) is commonly used to screen different types of genetic variation in humans and model species. Here, we performed aCGH using an oligonucleotide gene-expression array for a non-model species, the intertidal snail Littorina saxatilis. First, we tested what types of genetic variation can be detected by this method using direct re-sequencing and comparison to the Littorina genome draft. Secondly, we performed a genome-wide comparison of four closely related Littorina species: L. fabalis, L. compressa, L. arcana and L. saxatilis and of populations of L. saxatilis found in Spain, Britain and Sweden. Finally, we tested whether we could identify genetic variation underlying “Crab” and “Wave” ecotypes of L. saxatilis. Results: We could reliably detect copy number variations, deletions and high sequence divergence (i.e. above 3%), but not single nucleotide polymorphisms. The overall hybridization pattern and number of significantly diverged genes were in close agreement with earlier phylogenetic reconstructions based on single genes. The trichotomy of L. arcana, L. compressa and L. saxatilis could not be resolved and we argue that these divergence events have occurred recently and very close in time. We found evidence for high levels of segmental duplication in the Littorina genome (10% of the transcripts represented on the array and up to 23% of the analyzed genomic fragments); duplicated genes and regions were mostly the same in all analyzed species. Finally, this method discriminated geographically distant populations of L. saxatilis, but we did not detect any significant genome divergence associated with ecotypes of L. saxatilis. Conclusions: The present study provides new information on the sensitivity and the potential use of oligonucleotide arrays for genotyping of non-model organisms. Applying this method to Littorina species yields insights into genome evolution following the recent species radiation and supports earlier single-gene based phylogenies. Genetic differentiation of L. saxatilis ecotypes was not detected in this study, despite pronounced innate phenotypic differences. The reason may be that these differences are due to single-nucleotide polymorphisms.
2014-07-29 | GSE59825 | GEO
Project description:The interplay between phenotypic plasticity and adaptive evolution has long been an important topic of evolutionary biology. This process is critical to our understanding of a species evolutionary potential in light of rapid climate changes. Despite recent theoretical work, empirical studies of natural populations, especially in marine invertebrates, are scarce. In this study, we investigated the relationship between adaptive divergence and plasticity by integrating genetic and phenotypic variation in Pacific oysters from its natural range in China. Genome resequencing of 371 oysters revealed unexpected fine-scale genetic structure that is largely consistent with phenotypic divergence in growth, physiology, thermal tolerance and gene expression across environmental gradient. These findings suggest that selection and local adaptation are pervasive and together with limited gene flow shape adaptive divergence. Plasticity in gene expression is positively correlated with evolved divergence, indicating that plasticity is adaptive and likely favored by selection in organisms facing dynamic environments such as oysters. Divergence in heat response and tolerance implies that the evolutionary potential to a warming climate differs among oyster populations. We suggest that trade-offs in energy allocation are important to adaptive divergence with acetylation playing a role in energy depression under thermal stress.
2018-07-27 | PXD008057 | Pride
Project description:We used microarrays and a previously established linkage map to localize the genetic determinants of brain gene expression for a backcross family of lake whitefish species pairs (Coregonus sp.). Our goals were to elucidate the genomic distribution and sex-specificity of brain expression QTL (eQTL) and to determine the extent to which genes controlling transcriptional variation may underlie adaptive divergence in the recently evolved dwarf (limnetic) and normal (benthic) whitefish. We observed a sex-bias in transcriptional genetic architecture, with more eQTL observed in males, as well as divergence in genome location of eQTL between sexes. Hotspots of nonrandom aggregations of up to 32 eQTL in one location were observed. We identified candidate genes for species pair divergence involved with energetic metabolism, protein synthesis, and neural development based on co-localization of eQTL for these genes with eight previously identified adaptive phenotypic QTL and four previously identified outlier loci from a genome scan in natural populations. 88% of eQTL-phenotypic QTL co-localization involved growth rate and condition factor QTL, two traits central to adaptive divergence between whitefish species pairs. Hotspots co-localized with phenotypic QTL in several cases, revealing possible locations where master regulatory genes, such as a zinc finger protein in one case, control gene expression directly related to adaptive phenotypic divergence. We observed little evidence of co-localization of brain eQTL with behavioral QTL, which provides insight on the genes identified by behavioral QTL studies. These results extend to the transcriptome level previous work illustrating that selection has shaped recent parallel divergence between dwarf and normal lake whitefish species pairs and that metabolic, more than morphological differences appear to play a key role in this divergence. Keywords: eQTL mapping, gene expression, linkage mapping, adaptive radiation, Coregonus, microarrays
2008-09-01 | GSE12068 | GEO
Project description:Gene regulatory divergence is thought to play a central role in determining human-specific traits. However, our ability to link divergent regulation to divergent phenotypes is limited. Here, we utilized human-chimpanzee hybrid induced pluripotent stem cells to study divergent gene expression separating these species. The hybrid cells allowed us to separate cis- from trans-regulatory effects, and to control for non-genetic factors that often confound comparative studies. We differentiated these cells into cranial neural crest cells (CNCCs), the primary cell type giving rise to the face, and used the hybrid cells to generate a catalogue of divergent cis-regulatory gene expression between humans and chimpanzees. We found that cis-regulatory divergence is tightly linked to phenotypic divergence, enabling the identification of candidate genes associated with several divergent traits. Specifically, we find support for lineage-specific selection acting on the cis-regulation of the hedgehog signaling pathway. This pathway includes EVC2 (LIMBIN), whose cis-regulation is among the most divergent in the genome, resulting in 6-fold down-regulation along the human lineage. We found that inducing a similar reduction in EVC2 levels substantially reduces Hh signaling output. Mice and humans lacking functional EVC2 show striking parallels to many human-chimpanzee phenotypic differences, particularly in the skull and face, suggesting that the regulatory divergence of Hh signaling may have contributed to the unique craniofacial morphology of humans. In sum, our results suggest that human-chimpanzee hybrid cells can serve as a valuable resource to study the evolution of gene regulation and its impact on phenotypic divergence. SRA/fastq files include Illumina adapters (GATCGGAAGAGCACACGTCT and GATCGGAAGAGCGTCGTGTA).
2020-10-09 | GSE146481 | GEO
Project description:We used microarrays and a previously established linkage map to localize the genetic determinants of brain gene expression for a backcross family of lake whitefish species pairs (Coregonus sp.). Our goals were to elucidate the genomic distribution and sex-specificity of brain expression QTL (eQTL) and to determine the extent to which genes controlling transcriptional variation may underlie adaptive divergence in the recently evolved dwarf (limnetic) and normal (benthic) whitefish. We observed a sex-bias in transcriptional genetic architecture, with more eQTL observed in males, as well as divergence in genome location of eQTL between sexes. Hotspots of nonrandom aggregations of up to 32 eQTL in one location were observed. We identified candidate genes for species pair divergence involved with energetic metabolism, protein synthesis, and neural development based on co-localization of eQTL for these genes with eight previously identified adaptive phenotypic QTL and four previously identified outlier loci from a genome scan in natural populations. 88% of eQTL-phenotypic QTL co-localization involved growth rate and condition factor QTL, two traits central to adaptive divergence between whitefish species pairs. Hotspots co-localized with phenotypic QTL in several cases, revealing possible locations where master regulatory genes, such as a zinc finger protein in one case, control gene expression directly related to adaptive phenotypic divergence. We observed little evidence of co-localization of brain eQTL with behavioral QTL, which provides insight on the genes identified by behavioral QTL studies. These results extend to the transcriptome level previous work illustrating that selection has shaped recent parallel divergence between dwarf and normal lake whitefish species pairs and that metabolic, more than morphological differences appear to play a key role in this divergence. Keywords: eQTL mapping, gene expression, linkage mapping, adaptive radiation, Coregonus, microarrays The objective of this study was to elucidate the genomic distribution and sex-specificity of brain eQTL in dwarf and normal lake whitefish. Dissected brain tissue (250-350 mg) was sampled for 55 individuals from a hybrid x dwarf backcross mapping family. We used a loop design (YANG and SPEED 2002; CHURCHILL 2002) to maximize the number of sampled meioses. Each of 55 samples was technically replicated on two distinct slides, while performing dye swapping (Cy3 and Alexa) to estimate the dye intensity variation bias. After correcting for local background, raw intensity values were both log2 transformed and normalized using the regional LOWESS method implemented in the R/MANOVA software (KERR et al. 2000). We used a previously generated linkage map based on the same backcross individuals for which gene expression was measured. eQTL mapping was performed with QTL Cartographer.
2008-09-01 | E-GEOD-12068 | biostudies-arrayexpress
Project description:Polyploidization drives regulatory and phenotypic innovation. How the merger of different genomes contributes to polyploid development is a fundamental issue in evolutionary developmental biology and breeding research. Clarifying this issue is challenging because of genome complexity and the difficulty in tracking stochastic subgenome divergence during development. Recent single-cell sequencing techniques enabled probing subgenome divergent regulation in the context of cellular differentiation. However, analyzing single-cell data suffers from high error rates due to high-dimensionality, noise, and sparsity, and the errors stack up in polyploid analysis due to the increased dimensionality of comparisons between subgenomes of each cell, hindering deeper mechanistic understandings. Here, we developed a quantitative computational framework, pseudo-genome divergence quantification (pgDQ), for quantifying and tracking subgenome divergence directly at the cellular level. Further comparing with cellular differentiation trajectories derived from scRNA-seq data allowed for an examination of the relationship between subgenome divergence and the progression of development. pgDQ produces robust results and is insensitive to data dropout and noise, avoiding high error rates due to multiple comparisons of genes, cells, and subgenomes. A statistical diagonostic approach is proposed to identify genes that are central to subgenome divergence during development, which facilitates the integration of different data modalities, enabling the identification of factors and pathways that mediate subgenome-divergent activity during development. Case studies demonstrated that applying pgDQ to single cell and bulk tissue transcriptome data promotes a systematic and deeper understanding of how dynamic subgenome divergence contributes to developmental trajectories in polyploid evolution.
2024-09-20 | GSE224228 | GEO