Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Specific inhibition of splicing factor activity by decoy RNA oligonucleotides

ABSTRACT: Alternative splicing, a fundamental step in gene expression, is deregulated in many diseases. Splicing factors (SFs), which regulate this process, are up- or down regulated or mutated in several diseases including cancer. To date, there are no inhibitors that directly inhibit the activity of SFs. We designed decoy oligonucleotides, composed of several repeats of a RNA motif, which is recognized by a single SF. Here we show that decoy oligonucleotides targeting splicing factors RBFOX1/2, SRSF1 and PTBP1, can specifically bind to their respective SFs and inhibit their splicing and biological activities both in vitro and in vivo. These decoy oligonucleotides present a novel approach to specifically downregulate SF activity and have the potential to treat diseases where SFs are up-regulated, such as cancer.

OTHER RELATED OMICS DATASETS IN: PXD012564

ORGANISM(S): Homo sapiens

PROVIDER: GSE126503 | GEO | 2019/02/14

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Specific inhibition of splicing factor activity by decoy RNA oligonucleotides

Project description:Alternative splicing, a fundamental step in gene expression, is deregulated in many diseases. Splicing factors (SFs), which regulate this process, are up- or down regulated or mutated in several diseases including cancer. To date, there are no inhibitors that directly inhibit the activity of SFs. We designed decoy oligonucleotides, composed of several repeats of a RNA motif, which is recognized by a single SF. Here we show that decoy oligonucleotides targeting splicing factors RBFOX1/2, SRSF1 and PTBP1, can specifically bind to their respective SFs and inhibit their splicing and biological activities both in vitro and in vivo. These decoy oligonucleotides present a novel approach to specifically downregulate SF activity and have the potential to treat diseases where SFs are up-regulated, such as cancer.

2019-01-31 | PXD012564 | Pride

Specific inhibition of splicing factor activity by decoy RNA oligonucleotides

Project description:Specific inhibition of splicing factor activity by decoy RNA oligonucleotides

| PRJNA522237 | ENA

Development and validation of AI/ML derived splice-switching oligonucleotides

Project description:Splice-switching oligonucleotides (SSOs) are antisense compounds that act directly on pre-mRNA to modulate alternative splicing (AS). This study demonstrates the value that artificial intelligence/machine learning (AI/ML) provides for the identification of functional, verifiable, and therapeutic SSOs. We trained XGboost tree models using splicing factor (SF) pre-mRNA binding profiles and spliceosome assembly information to identify modulatory SSO binding sites on pre-mRNA. Using Shapley and out-of-bag analyses we also predicted the identity of specific SFs whose binding to pre-mRNA is blocked by SSOs. This step adds considerable transparency to AI/ML-driven drug discovery and informs biological insights useful in further validation steps. We applied this approach to previously established functional SSOs to retrospectively identify the SFs likely to regulate those events. We then took a prospective validation approach using a novel target in triple negative breast cancer (TNBC), NEDD4L exon 13 (NEDD4Le13). Targeting NEDD4Le13 with an AI/ML-designed SSO decreased the proliferative and migratory behavior of TNBC cells via downregulation of the TGFβ pathway. Overall, this study illustrates the ability of AI/ML to extract actionable insights from RNA-seq data.

2024-04-25 | GSE215917 | GEO

Cell cycle motif decoy oligos

Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do). genetic_modification_design

2012-08-23 | E-GEOD-39572 | biostudies-arrayexpress

Expression consequences of decoy vs scrambled oligonucleotides harboring AAAA[AGT]TT motif in MBA-MD-231 cell line

Project description:Dual-color transcriptional profiling of decoy-transfected cells, harboring AAAA[AGT]TT motif, versus scrambled-transfected cells as controls.

2009-11-04 | GSE18844 | GEO

Cell cycle motif decoy oligos

2012-08-23 | GSE39572 | GEO

Bone marrow derived human B cells [normal proB]

Project description:Aberrant splicing is a hallmark of leukemias with mutations in splicing factor (SF)-encoding genes. Here we investigated its prevalence in pediatric B-cell acute lymphoblastic leukemias (B-ALL), where SFs are not mutated. By comparing them to normal pro-B cells, we found thousands of aberrant local splice variations (LSVs) per sample, with 279 LSVs in 241 genes present in every comparison. These genes were enriched in RNA processing pathways and encoded ~100 SFs, e.g. hnRNPA1. hnRNPA1 3’UTR was most pervasively misspliced, yielding the transcript subject to nonsense-mediated decay. Thus, we knocked it down in B-lymphoblastoid cells, identified 213 hnRNPA1-dependent splicing events, and defined the hnRNPA1 splicing signature in pediatric leukemias. One of its elements was DICER1, a known tumor suppressor gene; its LSVs involved the 5’ UTR, suggestive of splicing as a mechanism of translational deregulation. Additionally, we searched for LSVs in other leukemia and lymphoma drivers and discovered 81 LSVs in 41 genes. 77 LSVs were confirmed using two large independent B-ALL RNA-seq datasets. In fact, the twenty most common B-ALL drivers showed higher prevalence of aberrant splicing than of somatic mutations. Thus, post-transcriptional deregulation of SF can drive widespread changes in B-ALL splicing and likely contribute to disease pathogenesis.

2018-10-02 | GSE115655 | GEO

Aberrant splicing in B-cell acute lymphoblastic leukemia [cell line]

2018-10-02 | GSE115654 | GEO

Alternative splicing analysis of pediatric B-cell acute lymphoblastic leukemia compared to normal bone marrow derived pro-B cells

2018-10-02 | GSE115656 | GEO

Aberrant splicing in B-cell acute lymphoblastic leukemia [B-ALL]

2018-10-02 | GSE115653 | GEO