Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Heterozygous and homozygous knock-in of PIK3CA-H1047R into human iPSCs

ABSTRACT: We used CRISPR/Cas9 to knock in the cancer "hotspot" mutation PIK3CA-H1047R into one or both alleles of a wild-type induced pluripotent stem cell (iPSC) line (WTC11; Coriell # GM25256; P37-P38). Three clones from each genotype (wild-type, heterozygous, homozygous) were subjected to single-end mRNA sequencing (mean read depth per sample: 20 million) to determine whether PIK3CA-H1047R exerts allele dose-dependent transcriptional effects. Multidimensional scaling demonstrated distinct transcriptomic signatures of wild-type, heterozygous and homozygous cells. The transcriptome of heterozygous cells was nearly identical to wild-type controls, with only 131 differentially-expressed transcripts (FDR = 0.05). In contrast, homozygosity for PIK3CA-H1047R led to differential expression of 1,914 genes. This indicates widespread transcriptional remodeling with a sharp allele dose-dependency, suggestive of a threshold effect.

ORGANISM(S): Homo sapiens

PROVIDER: GSE126562 | GEO | 2019/02/15

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

High-depth RNA sequencing of isogenic wild-type, PIK3CA-WT/H1047R and PIK3CA-H1047R/H1047R human iPSCs

Project description:We used CRISPR/Cas9 to knock in the cancer "hotspot" mutation PIK3CA-H1047R into one or both alleles of a wild-type induced pluripotent stem cell (iPSC) line (WTC11; Coriell # GM25256; P37-P38). Four cultures from each genotype (3 wild-type clones, 3 heterozygous clones, 2 homozygous clones) were subjected to paired-end mRNA sequencing (mean read length = 150 bp). The aim of this experiment was to confirm and expand upon previous transcriptomic results suggesting a near-binary transcriptional effect in homozygous versus heterozygous PIK3CA-H1047R iPSCs (publication doi: 10.1073/pnas.1821093116). According to the high-depth transcriptomic dataset, PIK3CA-H1047R/H1047R iPSCs exhibited altered expression of 5644 genes, whereas heterozygous hPSCs showed 492 differentially-expressed genes, supporting a nearly deterministic phenotypic effect of homozygosity for PIK3CA-H1047R. The differential gene expression analyses were performed based on the limma/voom/eBayes framework (doi: 10.1093/nar/gkv007), using customised scripts with FDR < 0.05 and absolute log2(fold-change) cut-off >= 1.3.

2019-10-01 | GSE134076 | GEO

High-dose oncogenic PIK3CA drives constitutive cellular stemness through increased NODAL/TGFb signaling

Project description:Oncogenic PIK3CA mutations activate phosphoinositide 3-kinase (PI3K) and are among the commonest somatic mutations in cancer and mosaic, developmental overgrowth disorders. We recently demonstrated that the ‘hotspot’ variant PIK3CAH1047R exerts striking allele dose-dependent effects on stemness in human induced pluripotent stem cells (iPSCs), and moreover demonstrated multiple oncogenic PIK3CA copies in a substantial subset of human cancers. To identify the molecular mechanism underpinning PIK3CAH1047R allele dose-dependent stemness, we profiled isogenic wild-type, PIK3CAWT/H1047R and PIK3CAH1047R/H1047R iPSCs by high-depth transcriptomics, proteomics and reverse-phase protein arrays (RPPA). PIK3CAH1047R/H1047R iPSCs exhibited altered expression of 5644 genes and 248 proteins, whereas heterozygous hPSCs showed 492 and 54 differentially-expressed genes and proteins, respectively, confirming a nearly deterministic phenotypic effect of homozygosity for PIK3CAH1047R. Pathway and network-based analyses predicted a strong association between self-sustained TGFb/NODAL signaling and the ‘locked’ stemness phenotype induced by homozygosity for PIK3CAH1047R. This stemness gene signature was maintained without exogenous NODAL in PIK3CAH1047R/H1047R iPSCs and was reversed by pharmacological inhibition of TGFb/NODAL signaling but not by PIK3CA-specific inhibition. Analysis of PIK3CA-associated human breast cancers revealed increased expression of the stemness markers NODAL and POU5F1 as a function of disease stage and PIK3CAH1047R allele dosage. Together with emerging realization of the link between NODAL re-expression and aggressive cancer behavior, our data suggest that TGFb/NODAL inhibitors warrant testing in advanced breast tumors with multiple oncogenic PIK3CA copies.

2021-03-03 | PXD014719 | Pride

High-depth RNA sequencing of isogenic wild-type, PIK3CA-WT/H1047R and PIK3CA-H1047R/H1047R human iPSCs

Project description:High-depth RNA sequencing of isogenic wild-type, PIK3CA-WT/H1047R and PIK3CA-H1047R/H1047R human iPSCs

| PRJNA553693 | ENA

Heterozygous and homozygous knock-in of PIK3CA-H1047R into human iPSCs

Project description:Heterozygous and homozygous knock-in of PIK3CA-H1047R into human iPSCs

| PRJNA522373 | ENA

Knock-in of PIK3CA-H1047R into MCF-10A

Project description:We have compared the proteome, transcriptome and metabolome of two isogenic cell lines: MCF-10A, derived from human breast epithelium, and the mutant MCF-10A-H1047R. These cell lines differ by a single amino acid substitution (H1047R) caused by single nucleotide change in one allele of the PIK3CA gene which encodes the catalytic subunit p110Î± of phosphatidylinositol 3-kinase (PI3K). The H1047R mutation of PIK3CA is one of the most frequently encountered somatic cancer-specific mutations. In MCF-10A, this mutation induces an extensive cellular reorganization that far exceeds the known signaling activities of PI3K. The changes are highly diverse; with examples in structural protein levels, the DNA repair machinery and sterol synthesis. Gene set enrichment analysis reveals a highly significant concordance of the genes differentially expressed in MCF-10A-H1047R cells and the established protein and RNA signatures of basal breast cancer. No such concordance was found with the specific gene signatures of other histological types of breast cancer. Our data document the power of a single base mutation, inducing an extensive remodeling of the cell toward the phenotype of a specific cancer. 2 cell lines (H1047R and WT), 4 time points (0, 6, 12, 24 hours), 3 replicates

2015-01-19 | E-GEOD-63452 | biostudies-arrayexpress

Gene expression of ErbB2-positive tumors harboring either wild type p110α or H1047R mutation

Project description:A mouse model utilizing knock in strategy to coexpress both oncogenic ErbB2 (NeuNT) and a PI3KCA mutation H1047R Microarray was used to determine gene expression change due to H1047R mutation by comparison between ErbB2 KI tumors expressing either wild type or mutant allele.

2022-03-11 | GSE198377 | GEO

Knock-in of PIK3CA-H1047R into MCF-10A

Project description:We have compared the proteome, transcriptome and metabolome of two isogenic cell lines: MCF-10A, derived from human breast epithelium, and the mutant MCF-10A-H1047R. These cell lines differ by a single amino acid substitution (H1047R) caused by single nucleotide change in one allele of the PIK3CA gene which encodes the catalytic subunit p110α of phosphatidylinositol 3-kinase (PI3K). The H1047R mutation of PIK3CA is one of the most frequently encountered somatic cancer-specific mutations. In MCF-10A, this mutation induces an extensive cellular reorganization that far exceeds the known signaling activities of PI3K. The changes are highly diverse; with examples in structural protein levels, the DNA repair machinery and sterol synthesis. Gene set enrichment analysis reveals a highly significant concordance of the genes differentially expressed in MCF-10A-H1047R cells and the established protein and RNA signatures of basal breast cancer. No such concordance was found with the specific gene signatures of other histological types of breast cancer. Our data document the power of a single base mutation, inducing an extensive remodeling of the cell toward the phenotype of a specific cancer.

2015-01-19 | GSE63452 | GEO

Development of gene expression signatures for MCF10A cell lines carrying HER2 and WT or H1047R PIK3CA oncogenes.

Project description:We wanted to know how introduction of H1047R oncogenic mutation of PIK3CA (p110a subunit of PI3K) in HER2-overexpressing MCF10A human non-transformed mammary epitheial cell lines introduces change in gene expression levels. Our control was HER2-overexpressing MCF10A cell line with wild-type (WT) PIK3CA. Mutated oncogene-induced gene expression signature was measured and compared with that induced by the WT oncogene from cell lines harvested at 70-80% confluency.

2021-03-16 | GSE117389 | GEO

Transcriptome analysis of tumors from genetically engineered mouse models carrying Cbfb and/or Pik3ca mutations

Project description:Tumors harvested from mice carrying positive MMTV-Cre transgene, homozygously or heterozygously deleted or wild type Cbfb allele, and heterozygous Pik3ca transgene were subject to RNA extraction. Extracted RNA with a RIN larger than 7 was subject to RNAseq. to generate the mice, breeder pairs of Gt(ROSA)26Sortm1(Pik3ca*H1047R)Egan/J (Stock No: 016977), Cbfbtm2.1Ddg/J (Stock No: 028550), and Tg(MMTV-Cre)4Mam/J (Stock No: 003553) strains were purchased from Jackson Laboratory. MMTV-Cre mice lines were genotyped using real time PCR [forward primer (FP): 5’-CCGGTTATTCAACTTGCACC-3' and reverse primer (RP) 5’-CTGCATTACCGGTCGATGCAAC- 3']. CBFB deletion was confirmed using real-time PCR with primers: FP: 5’-GCGCGCCAGTCACTTGTT-3' and RP: 5'- ATCCCACGAACCGAACCA-3'. Pik3ca mice were genotyped using primers; FP: 5'- AAAGTCGCTCTGAGTTGTTAT-3', RP1: 5'- GCGAAGAGTTTGTCCTCAACC -3' for mutant Pik3ca and RP2: 5'- GGAGCGGGAGAAATGGATATG -3' for wild type Pik3ca.

2024-10-22 | GSE206598 | GEO

Oncogenic PIK3CA(H1047R) and CTNNB1(stab) in intestinal organoids

Project description:Goals of the study was to compare transcripional and phenotypic response of mouse intestinal organoid cultures to the PIK3CA(H1047R) and CTNNB1(stab) oncogenes.

2017-04-12 | GSE93947 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data