Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Highly-motile versus unsorted MDA-MB-231 breast cancer cells

ABSTRACT: The challenge of predicting which patients with breast cancer will develop metastases leads to the overtreatment of patients with benign disease and to the inadequate treatment of the aggressive cancers. Here, we report the development and testing of a microfluidic assay that quantifies the abundance and proliferation of migratory cells in breast-cancer specimens, for the assessment of their metastatic propensity and for the rapid screening of potential antimetastatic therapeutics. On the basis of the key roles of cell motility and proliferation in cancer metastasis, the device accurately predicts the metastatic potential of breast-cancer cell lines and of patient-derived xenografts. Compared to unsorted cancer cells, highly motile cells isolated by the device exhibited similar tumourigenic potential but markedly increased metastatic propensity in vivo. RNA sequencing of the highly motile cells revealed an enrichment of motility-related and survival-related genes. The approach might be developed into a companion assay for the prediction of metastasis in patients and for the selection of effective therapeutic regimens.

ORGANISM(S): Homo sapiens

PROVIDER: GSE128313 | GEO | 2019/05/08

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Highly-motile versus unsorted MDA-MB-231 breast cancer cells

Project description:Highly-motile versus unsorted MDA-MB-231 breast cancer cells

| PRJNA527110 | ENA

Nm23-H1 suppresses tumor cell motility by downregulating the LPA receptor

Project description:Exogenous overexpression of the metastasis suppressor gene Nm23-H1 reduces the metastatic potential of multiple types of cancer cells. In addition, Nm23-H1 expression suppresses in vitro tumor cell motility and invasion, important correlates of metastasis. The molecular mechanism by which Nm23-H1 suppresses metastasis, motility and invasion has yet to be defined. However, mutational analysis of Nm23-H1 has revealed that substitution mutant P96S and S120G are unable to inhibit cell motility. To elucidate the molecular mechanism of Nm23-H1 motility suppression, we performed expression microarray analysis of an MDA-MB- 435 carcinoma cell line overexpressing wild-type Nm23-H1 and cross-compared the expression profile to lines expressing P96S and S120G mutants. Nine genes, MET, PTN, SMO, FZD1, L1CAM, MMP2, NETO2, CTGF and EDG2, were down regulated by wild-type but not by mutant Nm23-H1 expression (p<0.05). Reduced expression of these genes coincident with elevated Nm23-H1 expression was observed in human breast tumor cohorts, a panel of breast carcinoma cell lines and hepatocellular carcinomas from control and Nm23-M1 knockout mice. The functional significance of down regulated genes was assessed by transfection and in vitro motility assays. Only EDG2 overexpression significantly restored motility to Nm23-H1- suppressed cancer cells and it enhanced motility by 60-fold in these cells. In addition, silencing EDG2 expression with siRNA, reduced the motile phenotype of metastatic breast cancer cells. These data suggest that Nm23-H1 suppresses metastasis, at least in part, through downregulation of EDG2 expression and that compounds directed toward EDG2 may be useful for treating aggressive, low Nm23-H1-expressing breast tumors. Keywords: Human MDA-MB-435 Breast cancer derived cell lines

2007-04-30 | GSE7549 | GEO

Mitochondrial One-Carbon Flux has a Growth-Independent Role in Promoting Breast Cancer Metastasis

Project description:Progression of primary cancer to metastatic disease is the most common cause of death in cancer patients with minimal treatment options available. Canonical drugs mainly target the proliferative capacity of cancer cells, which often leaves slow-proliferating, persistent cancer cells unaffected. Thus, we aimed to identify metabolic determinants that enable cell plasticity and foster treatment resistance and tumor escape. Using a panel of anti-cancer drugs, we uncovered that antifolates, despite inducing strong growth arrest, did not impact the cancer cell’s motility potential, indicating that nucleotide synthesis is dispensable for cell motility. Prolonged treatment even selected for more motile cancer subpopulations. We found that cytosolic inhibition of DHFR by MTX only abrogates cytosolic folate cycle, while mitochondrial one-carbon cycle remains highly active. Despite a decreased cellular demand for biomass production, de novo serine synthesis and formate overflow are increased, suggesting that mitochondria provide a protective environment that allows serine catabolism to support cellular motility during nucleotide synthesis inhibition. Enhanced motility of growth-arrested cells was reduced by inhibition of PHGDH-dependent de novo serine synthesis and genetic silencing of mitochondrial one-carbon cycle. In vivo targeting of mitochondrial one-carbon cycle and formate overflow strongly and significantly reduced lung metastasis formation in an orthotopic breast cancer model. In summary, we identified mitochondrial serine catabolism as a targetable, growth-independent metabolic vulnerability to limit metastatic progression.

2022-06-09 | PXD027175 | Pride

Reanalysis of transcriptomic profiling of isolated CTC from 31 patients

Project description:The CTC-iChip microfluidic device [PMID: 23552373 ] enables isolation of rare viable circulating tumor cells (CTCs) directly from whole blood specimens of patients with cancer. Reanalysis of freshly isolated CTC from 31 women with hormone receptor positive metastatic breast cancer.

2023-06-20 | GSE215886 | GEO

MDA-MB-231 cells and p38 gamma knockdown

Project description:Compare highly motile MDA-MB-231 breast cancer cells with less motile, yet highly proliferative gamma p38 knockdowns

2014-03-22 | ST000043 | MetabolomicsWorkbench

Prognostic value of gene signatures and proliferation in lymph node negative breast cancer

Project description:Analyses whether, and if so, gene expression can add prognostic information in the subgroups of patients with tumours with low or high proliferative activity. As proliferation measured with MAI and PPH3 has repeatedly been shown to be the best prognosticator in node-negative breast cancer (high sensitivity, little overtreatment). Total RNA were extracted from 94 lymph node negative breast cancer patients

2014-03-05 | E-GEOD-46563 | biostudies-arrayexpress

Distant antimetastatic effect of enterotropic colon cancer-derived α4β7 CD8 T cells [3' single-cell RNA-seq]

Project description:Despite the high prognostic value of immune infiltrates in colorectal cancer (CRC), metastatic disease remains resistant to immunotherapy by immune checkpoint blockade (ICB). Here we show in a metastatic CRC multi-tumor preclinical model that orthotopically-implanted primary colon tumors can spontaneously exert a colon-specific and immune-dependent antimetastatic effect on distant hepatic lesions. An immune signature, integrating antitumor CD8 T cells, dendritic cells and protumor macrophages, that we called MicroEnvironment (ME)-score, was predictive of the antimetastatic effect. ScRNA-Seq and phenotypic analyses revealed that enterotropic α4β7 integrin expressing tumor neoantigen-specific CD8 T cells were key components of the systemic immune response responsible for the antimetastatic effect. Accordingly, the presence of concomitant colon tumors improved the efficacy of proof-of-concept ICB on liver lesions and generated a protective memory immune response whereas antibody-mediated partial depletion of α4β7+ cells abrogated the control of metastatic disease by the primary tumor. Finally, in a metastatic CRC patients’ cohort, we show increased expression of genes encoding the α4β7 integrin and of the ME-score in ICB responsive metastases concomitant with increased proportions of circulating α4β7+ CD8 T cells. Our findings identify a systemic cancer immunosurveillance role for gut primed tumor-specific α4β7+ CD8 T cells.

2023-11-01 | GSE193593 | GEO

Distant antimetastatic effect of enterotropic colon cancer-derived α4β7 CD8 T cells [bulk RNA-seq]

2023-11-01 | GSE193534 | GEO

Distant antimetastatic effect of enterotropic colon cancer-derived α4β7 CD8 T cells [scRNA-seq]

2023-11-01 | GSE219087 | GEO

Transcriptomic Profiling of Myosin 1e WT and KO 4T1 Cell Pools

Project description:Myosin 1e may influnece the metastatic spread of breast cancer cells as determined using the MMT-PyMT mouse model deficient in myo1e, which demonstrated no lung metastases. Therefore, we used CRISPR to knock out Myosin 1e (myo1e) in the 4T1 breast cancer line to study the effect on the propensity to metastasize. The Myosin 1e (Myo1e) WT and KO 4T1 cell pools were generated by Synthego using gRNA sequence 'CUUCUUCAGGUUCUCUACAA'.

2023-12-18 | GSE202685 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data