Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

PRMT1-mediated FLT3 arginine methylation promotes FLT3-ITD+ Acute Myeloid Leukemia maintenance

ABSTRACT: We want to obtain FLT3-ITD gene signature. To do so, we transduced CB CD34+ cells with mock or FLT3-ITD vectors and performed RNA sequencing (RNA-Seq). Two Groups: Group1: CB CD34+ cells transduced with mock vector; Group2: CB CD34+ cells transduced with FLT3-ITD vector;

ORGANISM(S): Homo sapiens

PROVIDER: GSE129754 | GEO | 2020/04/01

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Gene expression profile of mock and FLT3-ITD-expressing K562 cells.

Project description:We used whole genome microarray expression profiling as a discovery platform to identify genes regulated by FLT3-ITD activity. Viral particles with pMY-puro, pMY-puro-FLT3-ITD-1 or pMY-puro-FLT3-ITD-2, were generated using PLAT-gp packaging cells and infected to K562 cells. The vector-transduced cells were selected with 2µg/ml puromycin treatment.

2015-09-09 | E-GEOD-64330 | biostudies-arrayexpress

PRMT1-mediated FLT3 arginine methylation is required for maintenance of FLT3-ITD+ Acute Myeloid Leukemia

Project description:The presence of FLT3-ITD mutations in patients with acute myeloid leukemia (AML) is associated with poor clinical outcome. FLT3 tyrosine kinase inhibitors (TKIs), although effective in kinase ablation, do not eliminate FLT3-ITD+ leukemia stem cells (LSCs) which are potential sources of disease relapse, prompting us to ask whether FLT3-ITD protein regulates the AML LSCs survival through a kinase-independent mechanism. Here, we show that expression of PRMT1, the primary type I arginine methyltransferase, significantly increases in LSC-enriched CD34+CD38- populations relative to normal counterparts. Genetic PRMT1 depletion blocked AML CD34+ cell survival, and had more potent effects in AML cells from patients harboring FLT3-ITD. Our genome wide analysis of gene expression and PRMT1 conditional KO mouse study confirmed that PRMT1 preferentially cooperates with FLT3-ITD contributing to AML cell maintenance. Mechanistically, PRMT1 catalyzed FLT3-ITD protein methylation at arginines 972/973, and PRMT1 promoted leukemia cell growth in a FLT3 methylation-dependent manner. Moreover, effects of FLT3-ITD methylation in AML cells were in part due to crosstalk with FLT3-ITD phosphorylation at tyrosine 969 (Y969). Importantly, FLT3 methylation persisted in FLT3-ITD+ AML cells following TKI (AC220) treatment, indicating that methylation occurs independently of kinase activity. Finally, in both patient-derived xenograft (PDX) and murine AML models, combined administration of AC220 with a type I PRMT inhibitor (MS023) enhanced elimination of FLT3-ITD+ AML relative to AC220 treatment alone. Our study demonstrates that PRMT1-mediated FLT3 methylation promotes LSC activity and suggests that combining PRMT1 inhibition with FLT3 TKI treatment could be a promising approach to selectively target FLT3-ITD+ LSCs.

2021-11-10 | GSE122435 | GEO

RIPK3 restricts myeloid leukemogenesis by promoting cell death and differentiation of leukemia initiating cells

Project description:Examination of gene expression patterns in lineage negative FLT3-ITD– and pMIG-transduced BM cells via microarray study. We performed a global mRNA profiling analysis of murine Lin– FLT3-ITD+ cells compared to empty-vector controls, purified 48h after transduction. We examined association patterns of FLT3-ITD and pMIG cells and identified a specific gene expression signature associated with FLT3-ITD signalling.

2016-08-22 | GSE79040 | GEO

SIRT1 Activation Disrupts Maintenance of Myelodysplastic Syndrome Stem and Progenitor Cells by Restoring TET2 Function [microarray expression profiling]

Project description:Improved understanding of mechanisms regulating myelodysplastic syndrome (MDS) hematopoietic stem/progenitor cell (HSPC) growth and self-renewal is critical for developing MDS therapy. We revealed a novel regulatory axis that SIRT1-deficiency induced TET2 hyperacetylation promotes MDS HSPC functions, and provide an approach to target MDS HSPCs by activating SIRT1 deacetylase. Four Groups: Group1: MDS-L cells transduced with lentiviral vector targeting non-silence squence (control shRNA for SIRT1); Group2: MDS-L cells transduced with lentiviral vector containing interference squence targeting SIRT1 (SIRT shRNA); Group 3: MDS-L cells transduced with lentiviral vector targeting non-silence squence (control shRNA for TET2); Group 4: MDS-L cells transduced with lentiviral vector containing interference squence targeting TET2 (TET2 shRNA).

2018-08-13 | GSE117272 | GEO

RIPK3 restricts myeloid leukemogenesis by promoting cell death and differentiation of leukemia initiating cells

Project description:Examination of gene expression patterns in lineage negative FLT3-ITDâ and pMIG-transduced BM cells via microarray study. We performed a global mRNA profiling analysis of murine Linâ FLT3-ITD+ cells compared to empty-vector controls, purified 48h after transduction. We examined association patterns of FLT3-ITD and pMIG cells and identified a specific gene expression signature associated with FLT3-ITD signalling. Total RNA obtained from isolated lineage negative BM cells subjected to 48h of FLT3-ITD signalling compared to empty vector control.

2016-08-22 | E-GEOD-79040 | biostudies-arrayexpress

SYK Is a Critical Regulator of FLT3 In Acute Myeloid Leukemia

Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 Âµg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).

2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress

Molecular variability of FLT3/ITD mutants and their impact on the differentiation program of 32D cells

Project description:FLT3 is the most frequently mutated gene in AML â up to 40% of AML harbor an activating mutation within FLT3 gene. Though AML is a relatively rare disease, such a high mutability rate, as observed with FLT3 gene, is striking. To elucidate the molecular background of this phenomenon, we have established nine unique FLT3/ITD - carrying 32D cell lines and a set of controls, and subjected them to whole genome expression analysis and 2DE LC/MS proteomics. Data obtained on this so far largest set of ITD mutants indicates that in comparison to the wild type FLT3 expressing 32D cells and transduction controls, FLT3/ITD positive cells exhibit less mature expression profiles resembling ST-HSC and MkEP/CMP/LMPP progenitors. We hypothesize that FLT3/ITD might contribute not only to the proliferative advantage of FLT3/ITD positive cells, but also to their reprogramming towards less differentiated stages, thus strengthening their malignant properties. This finding might explain the pronounced mutation rate of the aberrantly expressed FLT3 gene in AML, and, also, the inferior prognosis of FLT3/ITD positive AML patients. Moreover, the microarray data has revealed biological differences among individual ITD variants â a finding supporting the recent clinical data on the prognostic impact of the size of individual ITDs. Keywords: genetic modification Nine stable 32D cell lines harboring unique human FLT3/ITD mutants, two parental 32 cell lines, two 32D stable cell lines harboring cloning vector only, and two 32D cell lines stably expressing human wild type FLT3 were subjected to the microarray analysis.

2010-04-08 | E-GEOD-12766 | biostudies-arrayexpress

Next generation sequencing identifies small RNA expression in FLT3-ITD+ AML (MV4-11) cell lines

Project description:The expression level of microRNAs in FLT3-ITD+ AML is unknown. Using empty vector (EV) lentiviral CRISPR-Cas9 infected FLT3-ITD+ AML cell lines (MV4-11 cells), we performed next generation RNA sequencing on small RNAs to determine microRNA expression level in these cells. We found a variety of evolutionarily conserved and non-conserved microRNAs expressed in our cells of interest.

2016-07-01 | GSE71543 | GEO

MS-based phosphoproteomic of cytarabine-treated FLT3-ITD cells

Project description:ITD mutations in the FLT3 gene occur in the 30% of acute myeloid leukemia patients. The integration of ITD in the tyrosine kinase domain (TKD-ITD) of the FLT3 receptor has been shown to confer resistance to standard chemotherapy treatment. We applied state-of-the-art, high-sensitive, mass spectrometry (MS)-based (phospho)proteomics to investigate the molecular mechanisms underlying the sensitivity to cytarabine therapy in FLT3-ITD cells.

2023-07-20 | PXD038638 | Pride

Expression profile of wild type (WT) vs miR-155-/- in FLT3-ITD+ AML (MV4-11) cell lines

Project description:The expression profile in miR-155-/- FLT3-ITD+ AML is unknown. Using empty vector (EV) or two distinct miR-155 (S3 or S10) lentiviral CRISPR-Cas9 infected FLT3-ITD+ AML cell lines (MV4-11 cells), we performed next generation RNA sequencing to determine the expression profile in these cells dependent on miR-155. We found a number of pathways dysregulated, including STAT5 activation.

2016-07-01 | GSE71541 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data