Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

SsDNA aptamers targeting Salmonella paratyphi A [SELEX]

ABSTRACT: Here, we report an ssDNA aptamer with high specificity and affinity towards Salmonella paratyphi A generated using the whole-cell SELEX process. The aptamers generated against an organism show salient features, such as higher affinity than existing antibodies, and are highly specific towards the targeted organism. Thus, the generated aptamer sequences can serve as potential biomarkers for the onsite detection of pathogens with high specificity and sensitivity. Molecular dynamics simulation was used to model the linear chain of the aptamers to a three-dimensional conformation, and the binding mechanism against DNA gyrase was established.

ORGANISM(S): Salmonella enterica subsp. enterica serovar Paratyphi A

PROVIDER: GSE137006 | GEO | 2019/12/31

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.

2019-09-30 | GSE124865 | GEO

ssDNA aptamers targeting Salmonella paratyphi A [SELEX]

Project description:ssDNA aptamers targeting Salmonella paratyphi A [SELEX]

| PRJNA564266 | ENA

Blocker-SELEX: A Structure-Guided Strategy for Developing Inhibitory Aptamers Disrupting Transcription Factor Interactions

Project description:Despite the well-established significance of transcription factors (TFs) in pathogenesis, their utilization as pharmacological targets has been limited by the inherent challenges mainly associated with modulating their protein-protein and protein-DNA interactions. The lack of defined small-molecule binding pockets and the nuclear localization of TFs makes neither small molecule inhibitors nor neutral antibodies suitable in blocking TF interactions. Aptamers are short oligonucleotides exhibiting high affinity and specificity for a diverse range of targets. The large molecular weights, expansive blocking surfaces and efficient cellular internalization make aptamers as a compelling molecular tool for traditional TF interaction modulators. Here, we report a structure-guided design strategy called Blocker-SELEX for developing inhibitory aptamers (iAptamer) that selectively block TF interactions. Our approach led to the discovery of an iAptamer that cooperatively disrupts SCAF4/SCAF8-RNA Polymerase II (RNAP2) interactions, thus dysregulates RNAP2 dependent gene expression and splicing, leading to the impairing of cell proliferation. This approach was further applied to develop iAptamers efficiently block WDR5-MYC interaction. Together, our study highlights the potential of Blocker-SELEX in developing iAptamers that effectively disrupt TF interactions, and the generated iAptamers hold promising implications as chemical tools in studying biological functions of TF interactions and the potential for nucleic acids drug development.

2024-02-01 | GSE254651 | GEO

Facile Discovery of Cell-surface Protein Targets of Cancer Cell Aptamers

Project description:Cancer biomarker discovery constitutes a frontier in cancer research. In recent years, cell-binding aptamers have become useful molecular probes for biomarker discovery. However, there are few successful examples, and the critical barrier resides in the identification of the cell-surface protein targets for the aptamers, where only a limited number of aptamer targets have been identified so far. Herein, we developed a universal SILAC-based quantitative proteomic method for target discovery of cell-binding aptamers. The method allowed for distinguishing specific aptamer-binding proteins from non-specific proteins based on abundance ratios of proteins bound to aptamer-carrying bait and control bait. In addition, we employed fluorescently labeled aptamers for monitoring and optimizing the binding conditions. We were able to identify and validate selectin L and integrin 4 as the protein targets for two previously reported aptamers, Sgc-3b and Sgc-4e, respectively. This strategy should be generally applicable for the discovery of protein targets for other cell-binding aptamers, which will promote the applications of these aptamers.

2022-02-28 | PXD002480 | Pride

Ultrahigh-throughput discovery of modified aptamers as specific and potent enzyme inhibitors

Project description:Enzymes are instrumental to life and key actors of pathologies, making them relevant drug targets. Most enzyme inhibitors consist of small molecules. Although efficient, their development is long, costly and can come with unwanted off-targeting. Substantial gain in specificity and discovery efficiency is possible using biologicals. Best exemplified by antibodies, these drugs derived from living systems display high specificity and their development is eased by harnessing natural evolution. Aptamers are nucleic acids sharing functional similarities with antibodies while being deprived of many of their limitations. Yet, the success rate of inhibitory aptamer discovery remained hampered by the lack of an efficient discovery pipeline. In this work, we addressed this issue by introducing an ultrahigh-throughput strategy combining in vitro selection, microfluidic screening and bioinformatics. We demonstrate its efficiency by discovering a modified aptamer that specifically and strongly inhibits SPM-1, a beta-lactamase that remained recalcitrant to the development of potent inhibitors.

2024-09-15 | E-MTAB-14407 | biostudies-arrayexpress

Selection of RNA aptamers against human islets by SELEX and toggle SELEX

Project description:Type 1 Diabetes is still an incurable disease characterized by autoimmune destruction of insulin-producing beta cells within the islet of Langerhans in the pancreas. Currently, there are no methods to monitor beta-cell mass in humans or deliver therapeutics specifically to beta cells. Here we performed Cluster Systematic Evolution of Ligands by Exponential Enrichment (SELEX) experiments and toggle SELEX experiments to identify RNA aptamers specific for human islets. In the cluster SELEX, we started from a random library of RNA nucleotides composed of a 40 nucleotide long variable region flanked by two constant regions. We performed eight selection cycles using hand-picked islets and islet-depleted acinar tissue from 4 cadaveric human donors as positive and negative selectors. In the toggle SELEX, we conducted eight cycles of selection using islets and acinar tissue from mice, followed by two cycles of selection using human tissues. The polyclonal libraries from the two selection strategies showed a convergent evolution of ligands and increased specificity for human islets.

2022-02-23 | GSE197262 | GEO

ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

Project description:ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

| PRJNA514043 | ENA

ACE-Scan of the ATP DNA aptamer on 10^12 density Gen1 DNA microarray

Project description:The experiments were carried out to map the ligand binding landscape of various DNA and RNA duplexed aptamer families. Duplexed Aptamer (DA) constructs were engineered from (i) natural and synthetic DNA and RNA aptamers and (i) synthetic oligonucleotide aptamer-complementary elements synthesized on custom DNA microarrays. The aptamers tested consist of the ATP DNA aptamer, the ATP RNA aptamer, the cocaine DNA aptamer, the human alpha-thrombin DNA aptamer, and the natural add riboswitch aptamer from the pathogenic bacteria Vibrio vulnificus. Each duplexed aptamer family consists of 1000's of synthetic constructs, each formed by hybridizing the aptamer with an aptamer-complementary element (ACE) - here, ACEs consisted of various DNA oligonucleotides synthesized as a custom DNA microarray.

2017-12-20 | E-MTAB-6374 | biostudies-arrayexpress

ACE-Scan of the ATP DNA aptamer on various density Gen2 DNA microarrays

2017-12-20 | E-MTAB-6375 | biostudies-arrayexpress

ACE-Scan of the cocaine DNA aptamer on 10^12 Gen1 DNA microarray

2017-12-20 | E-MTAB-6377 | biostudies-arrayexpress