PIK3CA and p53 mutations promote 4NQO-initated head and neck tumor progression and metastasis in mice
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
PROVIDER: GSE143716 | GEO | 2022/04/19
REPOSITORIES: GEO
Similar Datasets
Project description:PIK3CA and p53 mutations promote 4NQO-initated head and neck tumor progression and metastasis in mice
| PRJNA601436 | ENA
Project description:The PI3K signaling pathway is frequently mutated in head and neck squamous cell carcinoma (HNSCC), often via gain-of-function (GOF) mutations in the PIK3CA gene. Here, we present novel genetically engineered mouse models (GEMM) carrying a GOF allele Loxp-STOP-Loxp(LSL)-PIK3CAH1047R (E20) alone or in combination with heterozygous LSL-p53+/R172H (p53) mutation with tissue-specific expression to interrogate the role of oncogenic PIK3CA in transformation of upper aerodigestive track epithelium. We demonstrated that the GOF PIK3CA mutation promoted progression of 4-nitroquinoline 1-oxide-induced oral squamous cell carcinoma (OSCC) in both E20 single mutant and E20/p53 double mutant mice, with frequent distal metastasis detected only in E20/p53 GEMM. Similar to in human OSCC, loss of p16 was associated with progression of OSCC in these mice. RNA-seq analyses revealed that among the common genes differentially expressed in primary OSCC cell lines derived from E20, p53, and E20/p53 GEMMs compared with those from the wild-type mice, genes associated with proliferation and cell cycle were predominantly represented, which is consistent with the progressive loss of p16 detected in these GEMMs. Importantly, all of these OSCC primary cell lines exhibited enhanced sensitivity to BYL719 and cisplatin combination treatment in comparison with cisplatin alone in vitro and in vivo, regardless of p53 and/or p16 status. Given the prevalence of mutations in p53 and the PI3K pathways in HNSCC in conjunction with loss of p16 genetically or epigenetically, this universal increased sensitivity to cisplatin and BYL719 combination therapy in cancer cells with PIK3CA mutation represents an opportunity to a subset of patients with HNSCC. IMPLICATIONS: Our results suggest that combination therapy of cisplatin and PI3K inhibitor may be worthy of consideration in patients with HNSCC with PIK3CA mutation.
| S-EPMC7272268 | biostudies-literature
Project description:Nine groups of rat tongue tissue RNA samples, including three from normal control, three from 4NQO induced tongue tissue, and three from 4NQO induced and IL-1Ra interference tongue tissue (3 rats per group) were collected for gene microarray hybridization.
2017-02-11 | GSE42855 | GEO
Project description:Determine whether 4NQO treatment may modulate gene expression in mouse tongue. C57BL/6J mice were given 4NQO (100ug/ml in drink) for 8 weeks; Non-treated control samples were used for comparison.
2016-05-24 | GSE75374 | GEO
Project description:Despite extensive DNA sequencing of patient tumors, it remains challenging to translate the immense landscape of heterogeneous genetic alterations into function and clinical outcomes due to a limited understanding of cancer specific molecular network architectures. To bridge this gap, we have used affinity purification-mass spectrometry to generate protein interaction networks for 31 proteins with significant alterations in head and neck squamous cell carcinoma. This network includes 771 interactions covering both cancer and non-tumorigenic cell states, as well as wild-type and mutant proteins. Differential analysis across these dimensions reveals a strong interaction between PIK3CA and ERBB3 (HER3), dependent upon mutations in PIK3CA. We show that this interaction correlates with ERBB3 activity in vitro and can be targeted in vivo using a clinical ERBB3 inhibitor, CDX3379, to prohibit growth of tumors with common PIK3CA mutations. This study provides a roadmap for elucidating genetic complexity through multidimensional maps of cancer cell biology.
2021-10-07 | PXD019469 | Pride
Project description:Tumors harvested from mice carrying positive MMTV-Cre transgene, homozygously or heterozygously deleted or wild type Cbfb allele, and heterozygous Pik3ca transgene were subject to RNA extraction. Extracted RNA with a RIN larger than 7 was subject to RNAseq. to generate the mice, breeder pairs of Gt(ROSA)26Sortm1(Pik3ca*H1047R)Egan/J (Stock No: 016977), Cbfbtm2.1Ddg/J (Stock No: 028550), and Tg(MMTV-Cre)4Mam/J (Stock No: 003553) strains were purchased from Jackson Laboratory. MMTV-Cre mice lines were genotyped using real time PCR [forward primer (FP): 5’-CCGGTTATTCAACTTGCACC-3' and reverse primer (RP) 5’-CTGCATTACCGGTCGATGCAAC- 3']. CBFB deletion was confirmed using real-time PCR with primers: FP: 5’-GCGCGCCAGTCACTTGTT-3' and RP: 5'- ATCCCACGAACCGAACCA-3'. Pik3ca mice were genotyped using primers; FP: 5'- AAAGTCGCTCTGAGTTGTTAT-3', RP1: 5'- GCGAAGAGTTTGTCCTCAACC -3' for mutant Pik3ca and RP2: 5'- GGAGCGGGAGAAATGGATATG -3' for wild type Pik3ca.
2024-10-22 | GSE206598 | GEO
Project description:Recent studies have reported high frequencies of somatic mutations in the phosphoinositide-3-kinase catalytic alpha (PIK3CA) gene in several human solid tumors. Although gene amplifications of PIK3CA have been reported in head and neck squamous cell carcinoma (HNSCC), small mutation of the gene has not been evaluated in HNSCC previously. In this study, we examined the mutation frequency of PIK3CA in HNSCC.More than 75% of the somatic mutations of PIK3CA are clustered in the helical (exon 9) and kinase domains (exon 20). To investigate the possible role of PIK3CA in HNSCC tumorigenesis, exons 1, 4, 5, 6, 7, 9, and 20 of the gene were analyzed by direct genomic DNA sequencing in 38 HNSCC specimens.We identified four missense mutations in the seven exons of PIK3CA from 38 HNSCC specimens (11%). Three of the four mutations (i.e., H1047R, E542K, and E545K) have been previously reported as hotspot mutations. The remaining novel mutation, Y343C, is identified at exon 4 nucleotide 1028 A --> G. Three of the four mutations were shown to be somatic, whereas the fourth mutation (H1047R) was identified in a cell line. Interestingly, three of the four mutations identified were in pharyngeal cancer samples.These data provide evidence that oncogenic properties of PIK3CA contribute to the carcinogenesis of human head and neck cancers, especially in pharyngeal cancer. A specific kinase inhibitor to PIK3CA may potentially be an effective therapeutic reagent against HNSCC or pharyngeal cancer in particular.
| S-EPMC1780023 | biostudies-other
Project description:Objectives: Phosphatidylinositol 3-kinase catalytic subunit alpha (PIK3CA) is commonly altered in many human tumors, leading to the activation of p110α enzymatic activity that stimulates growth factor-independent cell growth. PIK3CA alterations such as mutation, gene amplification and overexpression are common in head and neck squamous cell carcinoma (HNSCC) and. We aim to explore how these alterations and clinical outcome are associated, as well as the molecular mechanisms involved. Material and methods: Mutation and copy-number variation in PIK3CA, and whole-genome expression profiles, were analyzed in primary HNSCC tumors from The Cancer Genome Atlas (TCGA) cohort (n=243). The results were validated in an independent cohort form the University Hospital of A Coruña (UHAC, n=62). Expression of the PIK3CA gene protein product (PI3K p110α) and nuclear YAP were assessed in tissue microarrays in a cohort from the University Hospital 12 de Octubre (UH12O, n=91). Results: Only high expression of the PIK3CA gene was associated with poor clinical outcome. The study of gene expression, transcription factor and protein signatures suggested that the activation of the Hippo-YAP pathway, involved in organ size, stem cell maintenance and tumorigenesis, could underlie tumor progression in PI3KCA overexpressing tumors. Tissue arrays showed that PI3K p110α levels correlated with YAP nuclear localization in HNSCC tumors. Conclusions: High expression of PIK3CA in HNSCC primary tumors identifies patients at high risk for recurrence. In these tumors, progression could rely on the Hippo-YAP pathway instead of the canonical Akt/mTOR pathway. This observation could have important implications in the therapeutic options for patients.
2018-04-02 | GSE95805 | GEO
Project description:In this study, we aimed to identifies the landscape alterations of intratumoral cell population in HNSCC from 4NQO-induced mice upon anti-CD276 treatment by using single cell sequencing analysis.we characterized the alterations of intratumoral cell population by separating cancer cells and yielded 6 distinct cancer cell subpopulations defined by the transcriptional state of cells and known marker genes, including the sunpopulation with pEMT, stress, typical epithelial differentiation, high cell-cycling, metabolism and immune fetures. In response of CD276 treatment, the frequecey of cells with pEMT, cell cycling and immune features are dcreased as compared to the vehicle control mice.
2021-05-28 | GSE164817 | GEO
Project description:The PIK3CA gene is frequently mutated in human cancers. To study the signaling mechanisms responsible for cell growth and invasion phenotypes induced by mutant PIK3CA molecules, we carried out a SILAC-based quantitative phosphoproteomic analysis of MCF10A, a spontaneously immortalized normal mammary epithelial cell line, and two MCF10A knockin cell lines containing different activating mutations of the PIK3CA gene. MCF10A and PIK3CA mutation knock in cells were propagated in DMEM/F12 SILAC media deficient in both L-lysine and L-arginine and supplemented with light lysine (K) and arginine (R) for light, 2H4-K and 13C6-R for medium state and 13C615N2-K and 13C615N4-R for heavy state labeling. Cell lysates were prepared in urea lysis buffer containing 20 mM HEPES pH 8.0, 9 M urea, 1 mM sodium orthovanadate, 2.5 mM sodium pyrophosphate, 1 mM ß-glycerophosphate and 5mM sodium fluoride. The lysates were reduced, alkylated and digested by trypsin. Tryptic peptides were desalted by C18 reverse phase column and followed by strong cation exchange (SCX) fractionation. Fractionated peptides were subjected to TiO2-based phosphopeptide enrichment. LC-MS/MS analysis of enriched phosphopeptides was carried out using a reverse-phase liquid chromatography system interfaced with an LTQ-Orbitrap Velos mass spectrometer. Proteome Discoverer (v 1.3) suite was used for quantitation and database searches. The tandem mass spectrometry data were searched using Mascot (2.2.0) and SEQUEST search algorithms against a Human RefSeq database supplemented with frequently observed contaminants.
2015-07-28 | PXD000599 | Pride