Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Global gene expression analysis of enveloping layer (EVL) and non-EVL cells from 6 hpf zebrafish embryos

ABSTRACT: RNA-seq data of EVL and non-EVL cells FACS sorted by the expression of GFP from the krt18 promoter (EVL cells). The analysis was performed with the aim to understand the global gene expression pattern of EVL cells in the context of their phagocytic activity detected in the accompanying manuscript

ORGANISM(S): Danio rerio

PROVIDER: GSE143734 | GEO | 2020/11/18

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Global gene expression analysis of enveloping layer (EVL) and non-EVL cells from 6 hpf zebrafish embryos

Project description:Global gene expression analysis of enveloping layer (EVL) and non-EVL cells from 6 hpf zebrafish embryos

| PRJNA601459 | ENA

Identification of differentially-expressed genes between FoxH1 morpholino and control in zebrafish embryos.

Project description:The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.

2007-07-30 | GSE8076 | GEO

Atac-seq of 2.5 hpf zebrafish embryos

Project description:Here we analyze the genome-wide accessability during zebrafish embryogenesis before zygotice genome activation 2.5 hours post fertilization

2017-12-01 | GSE100286 | GEO

Developing retina in zebrafish 55 hpf larval eye.

Project description: Not available

| EMPIAR-11759 | biostudies-other

Zebrafish 22 hpf embryos: WT vs. MO-grnA injected

Project description:Transcriptional profiling of zebrafish embryos comparing wild type untreated embryos with embryos injected with morpholino of zf-grna. This assay is used for the determination of expression profiling at 22 hpf under GRN-A deficiency. Two-condition experiment: wild type vs. MO-grnA treated cells. 3 biological replicates: each group contains 200 embryos.

2013-03-28 | E-GEOD-28318 | biostudies-arrayexpress

Defl1 knockdown gene expression in Zebrafish 12.5 hpf embryos

Project description:Microarray analysis was performed on tail bud stage morphants and stage-matched control injected embryos in order to determine any global gene expression changes occurring as a result of defbl1 knockdown.

2012-01-01 | GSE31766 | GEO

Zebrafish 22 hpf embryos: WT vs. MO-grnA injected

2013-03-28 | GSE28318 | GEO

ATR phosphoproteomics - substrate validation

Project description:ATR phosphoproteomics - Validation of ATR substrates as identified in phosphoproteomics screen. Sample Processing Protocol: Samples were processed as detailed in the accompanying manuscript. Data Processing Protol: Data were processed as detailed in the accompanying manuscript and the attached R script files.

2024-01-16 | PXD040476 | JPOST Repository

Transcriptional activation of zebrafish fads2 promoter and its transient transgene expression in yolk syncytial layer of zebrafish embryos.

Project description:The front-end desaturases (Fads) are rate-limiting enzymes responsible for production of long-chain polyunsaturated fatty acids (LC-PUFA). The full spectrum of the transcriptional regulation of fads is still incomplete, as cloning of fads promoter is limited to a few species. Here, we described the cloning and characterisation of the zebrafish fads2 promoter. Using 5'-deletion and mutation analysis on this promoter, we identified a specific region containing the sterol regulatory element (SRE) which is responsible for the activation of the fads2 promoter. In tandem, two conserved CCAAT boxes were also present adjacent to the SRE and mutation of either of these binding sites attenuates the transcriptional activation of the fads2 promoter. An in vivo analysis employing GFP reporter gene in transiently transfected zebrafish embryos showed that this 1754 bp upstream region of the fads2 gene specifically directs GFP expression in the yolk syncytial layer (YSL) region. This indicates a role for LC-PUFA in the transport of yolk lipids through this tissue layer. In conclusion, besides identifying novel core elements for transcriptional activation in zebrafish fads2 promoter, we also reveal a potential role for fads2 or LC-PUFA in YSL during development.

| S-EPMC5832746 | biostudies-literature

Defl1 knockdown gene expression in Zebrafish 12.5 hpf embryos

2012-01-01 | E-GEOD-31766 | biostudies-arrayexpress