Dataset Information

Retrieving high-resolution chromatin interactions and decoding enhancer regulatory potential in silico

ABSTRACT: The advent of the chromosome conformation capture (3C) and related technologies has profoundly renewed our understaning of three-dimensional chromatin folding in mammalian nuclei. Alongside these experimental approaches, numerous computational tools for handling, normalizing, visualizing, and ultimately detecting interactions in 3C-type datasets are being developed. Here, we present Bloom, a comprehensive method for the analysis of 3C-type data matrices on the basis of Dirichlet process mixture models that addresses two important open issues. First, it retrieves occult interaction patterns from sparse data, like those derived from single-cell or “native” Hi-C experiments; thus, bloomed sparse data can now be used to study interaction landscapes at high-resolution. Second, it detects enhancer-promoter interactions with high sensitivity and inherently assigns an interaction frequency score (IFS) to each contact. Using enhancer perturbation data of different throughput, we show that IFS accurately quantifies the regulatory influence of each enhancer on its target promoter. As a result, Bloom allows decoding of complex regulatory landscapes by generating functionally-relevant enhancer atlases solely on the basis of 3C-type data.

ORGANISM(S): Mus musculus Homo sapiens

PROVIDER: GSE161636 | GEO | 2021/12/01

REPOSITORIES: GEO

ACCESS DATA

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Project description:CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells. The 3C-Seq design and data analysis were performed according to Stadhouders et al, Nat Protoc. 2013, 8:509-524. A series of bait sequences accommodating different locus around CCAT1-L and MYC were selected. Through integrating with specific sample barcodes, bait-specific primer sets were designed to construct relevant 3C-seq libraries in CCAT1-L knockdown and scramble knockdown (Scr) HT29 samples. All of the 3C sample libraries from different treatment, including CCAT1-L knockdown and scramble knockdown (Scr), were then pooled together for high-throughput sequencing. Two technical 3C-seq were performed (CCAT1_myc_3C_1.txt.gz and CCAT1_myc_3C_2.txt.gz) and then combined together to get enough reads for further analysis. 3C-seq reads from different samples were divided according to sample barcodes (CCAT1-L knockdown: ATGTCA; Scr: GCCAAT) and different bait sequences, and then mapped to human reference genome to assess chromatin interaction strength between CCAT1-L and MYC locus in different treatments. In our study, one representative bait-specific sequencing data (CTTCTACTGATTGGCCCTAAACACTTTTCCAAAGCTT) was select to generate bedgraph files and upload to UCSC for visualization to show the chromatin interaction between CCAT1-L and Myc locus in CCAT1-L knockdown (CCAT1-L_knockdown_out.bedgraph) and scramble knockdown (Scr_out.bedgraph) samples.

Project description:Epstein-Barr virus (EBV) epigenetically reprogrammes B-lymphocytes to drive immortalization and facilitate viral persistence. Host-cell transcription is perturbed principally through the actions of EBV EBNA 2, 3A, 3B and 3C, with cellular genes deregulated by specific combinations of these EBNAs through unknown mechanisms. Comparing human genome binding by these viral transcription factors we discovered that 25% of binding sites were shared by EBNA 2 and the EBNA 3s and were located predominantly in enhancers. Moreover, 80% of potential EBNA 3A, 3B or 3C target genes were also targeted by EBNA 2, implicating extensive interplay between EBNA 2 and 3 proteins in cellular reprogramming. Investigating shared enhancer sites neighbouring two new targets (WEE1 and CTBP2) we discovered that EBNA 3 proteins repress transcription by modulating enhancer-promoter loop formation to establish repressive chromatin hubs or prevent assembly of active hubs. Re-ChIP analysis revealed that EBNA 2 and 3 proteins do not bind simultaneously at shared sites but compete for binding thereby modulating enhancer-promoter interactions. At an EBNA 3-only intergenic enhancer site between ADAM28 and ADAMDEC1 EBNA 3C was also able to independently direct epigenetic repression of both genes through enhancer-promoter looping. Significantly, studying shared or unique EBNA 3 binding sites at WEE1, CTBP2, ITGAL (LFA-1 alpha chain), BCL2L11 (Bim) and the ADAMs, we also discovered that different sets of EBNA 3 proteins bind regulatory elements in a gene and cell-type specific manner. Binding profiles correlated with the effects of individual EBNA 3 proteins on the expression of these genes, providing a molecular mechanism for the targeting of different sets of cellular genes by the EBNA 3s. Our results therefore highlight the influence of the genomic and cellular context in determining the specificity of gene deregulation by EBV and provide a paradigm for host-cell reprogramming through modulation of enhancer-promoter interactions by viral transcription factors. Examination of EBNA 3 protein binding (EBNA 3A, 3B and 3C) using a pan-specific antibody and EBNA 2 binding in single ChIP-seq experiments carried out in the Mutu III Burkitt's lymphoma cell-line.

Dataset Information

Retrieving high-resolution chromatin interactions and decoding enhancer regulatory potential in silico

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets