A programmable pAgo nuclease with universal guide and target specificity from the mesophilic bacterium Kurthia massiliensis
Ontology highlight
ABSTRACT:
ORGANISM(S): Escherichia coli
PROVIDER: GSE168010 | GEO | 2021/03/02
REPOSITORIES: GEO
Similar Datasets
Project description:To study target sequence specificity, selectivity, and reaction kinetics of Streptococcus pyogenes Cas9 activity, we challenged libraries of random variant targets with purified Cas9::guide RNA complexes in vitro. Cleavage kinetics were nonlinear, with a burst of initial activity followed by slower sustained cleavage. Consistent with other recent analyses of Cas9 sequence specificity, we observe considerable (albeit incomplete) impairment of cleavage for targets mutated in the PAM sequence or in "seed" sequences matching the proximal 8 bp of the guide. A second target region requiring close homology was located at the other end of the guide::target duplex (positions 13-18 relative to the PAM). Strikingly, a subset of variants which broke homology in the intervening region consistently increased the capacity of Cas9 to cleave in extended reactions. Sequences flanking the guide+PAM region had measurable (albeit modest) effects on cleavage. Taken together, these studies provide both a basis for predicting effective cleavage targets and a basis for potential optimization of guide RNAs to yield efficiency beyond that of the simple perfect-match guides.
2014-11-14 | GSE58426 | GEO
Project description:A programmable pAgo nuclease with universal guide and target specificity from the mesophilic bacterium Kurthia massiliensis
| PRJNA705755 | ENA
Project description:The bacterial CRISPR-Cas9 system has been widely adapted for RNA-guided genome editing and gene regulation in diverse organisms yet its in vivo target specificity is poorly understood. Here we provide the first genome-wide binding maps of nuclease-deactivated Cas9 loaded with guide RNAs in mammalian cells. We find a 5-nucleotide seed region in the guide RNA targets Cas9 to thousands of sites in the genome. Chromatin accessibility limits binding to the other hundreds of thousands sites with matching seed sequences, and consequently 70% of off-target binding sites are associated with genes. U-rich seeds have low numbers of off-target sites limited by both low guide RNA abundance and scarcity of complimentary sites in accessible chromatin. Unexpectedly, off-target sites show little evidence of cleavage, supporting a two-state model reminiscent of eukaryotic RNAi machinery where a short seed match triggers binding but extensive pairing is required for cleavage.
2014-04-20 | GSE54745 | GEO
Project description:The bacterial CRISPR-Cas9 system has been widely adapted for RNA-guided genome editing and gene regulation in diverse organisms yet its in vivo target specificity is poorly understood. Here we provide the first genome-wide binding maps of nuclease-deactivated Cas9 loaded with guide RNAs in mammalian cells. We find a 5-nucleotide seed region in the guide RNA targets Cas9 to thousands of sites in the genome. Chromatin accessibility limits binding to the other hundreds of thousands sites with matching seed sequences, and consequently 70% of off-target binding sites are associated with genes. U-rich seeds have low numbers of off-target sites limited by both low guide RNA abundance and scarcity of complimentary sites in accessible chromatin. Unexpectedly, off-target sites show little evidence of cleavage, supporting a two-state model reminiscent of eukaryotic RNAi machinery where a short seed match triggers binding but extensive pairing is required for cleavage. ChIP-seq of HA-dCas9 loaded with 4 sgRNAs (Phc1-sg1, Phc1-sg2, Nanog-sg2, and Nanog-sg3) in mouse, and 2 sgRNAs in human (EMX1-sg1 and EMX1-sg3)
2014-04-20 | E-GEOD-54745 | biostudies-arrayexpress
Project description:We solved the crystal structure of human ARGONAUTE1 (hAGO1) bound to endogenous 5'-phosphorylated guide RNAs. To identify structural changes that evolutionarily rendered hAGO1 inactive, we compared our structure with published structures of guide-RNA-containing and cleavage-active hAGO2. Aside from mutation of a catalytic tetrad residue, proline residues at positions 670 and 675 in hAGO1 introduce a kink in the cS7 loop and thereby forming a convex surface within the hAGO1 nucleic-acid-binding channel near the inactive catalytic site. We predicted that even upon restoration of the catalytic tetrad, hAGO1-cS7 sterically hinders the placement of a fully-paired guide-target RNA duplex into the endonuclease active site. Consistent with this hypothesis, reconstitution of the catalytic tetrad (R805H) led to low level hAGO1 cleavage activity, whereas combining R805H with cS7 substitutions (P670S and P675Q) substantially augmented hAGO1 activity. Evolutionary changes to hAGO1 were subtle and readily reversible, suggesting that loading of guide RNA and seed-based miRNA-target RNA pairing constrain its sequence drift.
2013-06-20 | GSE48076 | GEO
Project description:Clustered regularly interspaced short palindromic repeat (CRISPR) RNA-guided nucleases have gathered considerable excitement as a tool for genome engineering. However, questions remain about the specificity of their target site recognition. Most previous studies have examined predicted off-target binding sites that differ from the perfect target site by one to four mismatches, which represent only a subset of genomic regions. Here, we used ChIP-seq to examine genome-wide CRISPR binding specificity at gRNA-specific and gRNA-independent sites. For two guide RNAs targeting the murine Snurf gene promoter, we observed very high binding specificity at the intended target site while off-target binding was observed at 2- to 6-fold lower intensities. We also identified significant gRNA-independent off-target binding. Interestingly, we found that these regions are highly enriched in the PAM site, a sequence required for target site recognition by CRISPR. To determine the relationship between Cas9 binding and endonuclease activity, we used targeted sequence capture as a high-throughput approach to survey a large number of the potential off-target sites identified by ChIP-seq or computational prediction. A high frequency of indels was observed at both target sites and one off-target site, while no cleavage activity could be detected at other ChIP-bound regions. Our results demonstrate that even a simple configuration of a Cas9:gRNA nuclease can support very specific DNA cleavage activity and that most interactions between the CRISPR nuclease complex and genomic PAM sites do not lead to DNA cleavage. ChIP-seq using dCas9 to determine genome-wide binding of CRISPR/Cas9 noED: Cas9 doublemutant protein without an effector domain KRAB: Cas9 doublemutant protein fused to the KRAB repressor domain S1 gRNA: guide RNA targeting GCTCCCTACGCATGCGTCCC(AGG) in the mouse genome S2 gRNA: guide RNA targeting AATGGCTCAGGTTTGTCGCG(CGG) in the mouse genome VEGFA TS3 gRNA: guide RNA targeting GGTGAGTGAGTGTGTGCGTG(TGG) in the human genome
2015-03-04 | E-GEOD-61099 | biostudies-arrayexpress
Project description:To study target sequence specificity, selectivity, and reaction kinetics of Streptococcus pyogenes Cas9 activity, we challenged libraries of random variant targets with purified Cas9::guide RNA complexes in vitro. Cleavage kinetics were nonlinear, with a burst of initial activity followed by slower sustained cleavage. Consistent with other recent analyses of Cas9 sequence specificity, we observe considerable (albeit incomplete) impairment of cleavage for targets mutated in the PAM sequence or in "seed" sequences matching the proximal 8 bp of the guide. A second target region requiring close homology was located at the other end of the guide::target duplex (positions 13-18 relative to the PAM). Strikingly, a subset of variants which broke homology in the intervening region consistently increased the capacity of Cas9 to cleave in extended reactions. Sequences flanking the guide+PAM region had measurable (albeit modest) effects on cleavage. Taken together, these studies provide both a basis for predicting effective cleavage targets and a basis for potential optimization of guide RNAs to yield efficiency beyond that of the simple perfect-match guides. 118 samples anaylzed. Controls have con in sample name. To quantitatively measure cleavage efficiency of a single gRNA, we created a population of random variant target sequences to two gRNA targets. The targets used were "unc-22A", [a sequence from the well-characterized unc-22 gene of Caenorhabditis elegans], and "protospacer 4" (ps4), a previously characterized sequence from a natural spacer from S. pyogenes MGAS10750 . Using custom mixtures of oligonucleotide precursors for each base during chemical synthesis, a set of polymorphic target libraries ('Random Variant Libraries') were designed to have a baseline variation rate at each position. On each side of the gRNA homology and PAM regions, 6 bps of random sequence were added. The first base of intended gRNA homology is designated base 1 . The entire 35 bp random variant library mixture was cloned into a standard plasmid vector (pHRL-TK). Several thousand colonies from plates were washed in pools and prepared by standard plasmid preparation methods. The complexity of the libraries were estimated based on Illumina sequencing of the uncut libraries and filtering for minimum representation expected from the pooling. Approximately 1500-3000 unique species were obtained in the unc-22A libraries and 5000 unique sequences in the ps4 library (see Materials and Methods). To assay cleavage, purified Cas9 was first incubated with gRNA, followed by incubation with the variant library for various time points and under various conditions. DNA template is among the conditions varied in the experiments. After protein removal, flanking sequences outside of the target region are used for PCR amplification and plasmid cleavage was measured through loss of PCR products that span the region of interest. A set of perfectly matched targets and highly mutated versions present in the random variant library served as internal positive and negative controls respectively. A log retention score for each sequence in each experiment was calculated by quantifying the representation of each sequence before and after addition of the Cas9 protein. Two approaches were used for normalization: first we used a population of ps4 targets "spiked" into the library as an uncleaved control, second, we used a population of unc-22A targets with large numbers of variations from the perfect target (between 4 and 7), and hence likely limited if any cleavage. Equivalent results are obtained with these two normalization approaches (see Computational Methods for details). Retention scores are expressed as the log2 of the normalized ratio, so that a more negative retention score indicates efficient cleavage of substrate while a less negative score indicates less cleavage. Templates which are uncleaved will yield a retention score at or near zero. Comparisons between multiple experiments indicate strong correlation between independent retention measurements. GSM1410678-GSM1410761; AF_SOL*.dat' files contain the calculated final retentions for each experiment. Each experiment labeled: M-bM-^@M-^\AF_SOL_###_t###M-bM-^@M-^]. M-bM-^@M-^\AF_SOL_###M-bM-^@M-^] corresponds to the experiment run ID and M-bM-^@M-^\t###M-bM-^@M-^] corresponds to the incubation time of the experiment. For example AF_SOL_513_t360, corresponds to experiment 513 on the protospacer 4 guide and DNA target and the incubation time was 360 mins. The experimental conditions and ID can be found in the associated publication. GSM1544297-GSM1544332; unc*.dat file is a tab-delimited file of all considered sequences in each experiment. The names of the files and the AF_SOL_# run number can be found in the associated publication (Supplementary Materials) with the details of the conditions. Each filename starts with the type of gRNA used (either unc-22WT or the mutant version unc22C11G). The next number (#min) is indication of the time of incubation for the experiment and this is either followed by #pcr_AF_SOL_# or just AF_SOL_#. If followed by #pcr, that is the indication of the number of PCR cycles used in the experiments. Finally, AF_SOL_# denotes the sequencing run ID number.
2014-11-14 | E-GEOD-58426 | biostudies-arrayexpress
Project description:We solved the crystal structure of human ARGONAUTE1 (hAGO1) bound to endogenous 5'-phosphorylated guide RNAs. To identify structural changes that evolutionarily rendered hAGO1 inactive, we compared our structure with published structures of guide-RNA-containing and cleavage-active hAGO2. Aside from mutation of a catalytic tetrad residue, proline residues at positions 670 and 675 in hAGO1 introduce a kink in the cS7 loop and thereby forming a convex surface within the hAGO1 nucleic-acid-binding channel near the inactive catalytic site. We predicted that even upon restoration of the catalytic tetrad, hAGO1-cS7 sterically hinders the placement of a fully-paired guide-target RNA duplex into the endonuclease active site. Consistent with this hypothesis, reconstitution of the catalytic tetrad (R805H) led to low level hAGO1 cleavage activity, whereas combining R805H with cS7 substitutions (P670S and P675Q) substantially augmented hAGO1 activity. Evolutionary changes to hAGO1 were subtle and readily reversible, suggesting that loading of guide RNA and seed-based miRNA-target RNA pairing constrain its sequence drift. Structure-guided design of mutations that confer slicer activity to hAGO1. RNAs were isolated from recombinant purified hAGO1 and hAGO2, processed from baculovirus-infected Trichoplusia ni insect cells, and then processed for Illumina HiSeq. In addition, total RNA samples from AGO1 baculouvirus infected vs. non-infected Trichoplusia ni cells were isolated and also processed for Illumina HiSeq.
2013-06-20 | E-GEOD-48076 | biostudies-arrayexpress
Project description:Engineered RNA elements are programmable tools capable of detecting small molecules, proteins, and nucleic acids. Predicting the behavior of these tools remains a challenge, a situation that could be addressed through enhanced pattern recognition from deep learning. Thus, we investigate Deep Neural Networks (DNN) to predict toehold switch function as a canonical riboswitch model in synthetic biology. To facilitate DNN training, we synthesized and characterized in vivo a dataset of 91,534 toehold switches spanning 23 viral genomes and 906 human transcription factors. DNNs trained on nucleotide sequences outperformed (R2=0.43-0.70) previous state-of-the-art thermodynamic and kinetic models (R2=0.04-0.15) and allowed for human-understandable attention-visualizations (VIS4Map) to identify success and failure modes. This deep learning approach constitutes a major step forward in engineering and understanding of RNA synthetic biology.
2020-08-12 | GSE149225 | GEO
Project description:Members of the conserved Argonaute protein family use small RNA guides to find their mRNA targets to regulate gene expression and suppress mobile genetic elements in eukaryotes. Argonautes are also present in many bacterial and archaeal species. Unlike eukaryotic proteins, several studied prokaryotic Argonautes use small DNA guides to cleave DNA, a process dubbed DNA interference. However, the natural functions and targets of DNA interference are poorly understood and the mechanisms of DNA guide generation and target discrimination remain unknown. Here, we studied the in vivo activities of a bacterial Argonaute nuclease CbAgo and demonstrated that it induces cleavage of multicopy genetic elements, including plasmids, transposons and repetitive chromosomal loci. Generation of small DNA guides employed by CbAgo requires cooperation between its intrinsic endonuclease activity and the cellular double-strand break repair machinery. The mechanism of guide generation ensures that small DNA guides are enriched in sequences that target foreign DNA and endows CbAgo with capacity to eliminate plasmids and fight phage infection. Similar principles may underlie the specificity of self-nonself discrimination by diverse defense systems in prokaryotes.
2020-07-30 | GSE148595 | GEO