Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Transcriptomics analysis of gene expression in wildtype and foxo1 synonymous mutated mouse liver

ABSTRACT: The selected gRNA sequence is tggcatgtttattgagcgctTGG. To disrupt the demethylation motif RRACT in 2288-2290 of Foxo1 mRNA (NM_019739), a mutation (ttGGACT to ctCGATT) target vector was constructed with 1214bp 5’arm and 849bp 3’arm. Mouse zygotes obtained by mating of males with superovulated C57BL/6J females, were injected with a mixture of Cas9 mRNA (80 ng/μl), sgRNA (40 ng/ul) and Donor vector (8 ng/ul). Microinjections were performed into the male pronucleus of fertilized oocytes. Injected zygotes were transferred into pseudopregnant CD1 female mice, and viable adult mice were obtained. Mice were genotyped using sequencing and PCR. PCR primers: mut-F1, ATCCCCATTGAGCAGTAAGTTTTCCA; mut-R1, TGATGGACTCCATGTCACAATCGAG; mut-F2, GCATGTTTATTGAGCGCCTCGAT; mut-R2, CCGCTGTTGCCAAGTCTGAGG; wt-R1, TGATGGACTCCATGTCACAGTCCAA. PCR genotyping of wild-type (wt) and mutant (mut) mice was using primers mut-F1 and mut-R1 to generate fragments of 1291 bp for mut allele, using primers mut-F2 and mut-R2 to generate fragments of 930 bp for mut allele, and using primers mut-F1 and wt-R1 to generate fragments of 1291 bp for wt allele. Total RNA was isolated from Liver Tissue using the TRIzol (Invitrogen) reagent by following the company manual. For all samples the RNA integrity was checked using an Agilent Bioanalyzer 2100. Approximately 2.5 µg of total RNA was then used for library preparation using a TruSeq™ RNA Sample Prep Kit v2 (Illumina, San Diego, CA, USA) according to the manufacturer’s protocol.The libraries were sequenced using HiSeq3000 (Illumina) in paired-read mode, creating reads with a length of 101 bp. Sequencing chemistry v2 (Illumina) was used.

ORGANISM(S): Mus musculus

PROVIDER: GSE125786 | GEO | 2022/01/26

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Integration sites sequencing of HIV infection on ZNF417 ZNF587 dKO 293T cells

Project description:We infected ZNF417 ZNF587 dKO 293T or control 293T with NL4.3 virus for 48 hours. Then genomic DNA was purified from cell lysis with by phenol chloroform. DNA was sheared into 300 bp-500 bp random fragments using Covaris Adaptive Focused Acoustics (Covaris, Woburn, MA). Sheared DNA was ligated with a linker and PCR with primers targeting HIV LTR and linker. PCR products were performed second PCR with Illumina adaptor primers. Libraries were so constructed and sequenced on Novaseq 6000.

2021-12-31 | GSE174239 | GEO

Transcription profiling by array of mouse wild type and Prss16 knockouts

Project description:Transcription profiling of Prss16 Tssp can be used to evidentiate further endopeptidase genes candidate to self-peptide generation in the thymus. All mice studied were C57BL/6 background and KO (knockout) Prss16-deficient mice were previously obtained by homologous recombination in embryonic stem (ES) cells of a targeting vector carrying Neo resistance gene marker, which has allowed replacement of exons 8 to 12 of the Prss16 gene in KO mice (data not shown). Briefly, one properly targeted ES clone was injected into BALB/c blastocysts to generate chimeric mice. Chimeric males were mated to C57BL/6 females to generate heterozygous pups in which the Neo selection cassette had been excised. Mice heterozygous for the mutation,originally on mixed 129/Sv x C57BL/6 genetic background, were intercrossed to generate homozygous mutants (Prss16-/-), WT (Prss16+/+) and heterozygousmutants (Prss16+/-) littermates. Genotype analysis was performed on genomic DNA from tail biopsies using PCR primers F (5M-^R GCCTGACACAAGTCGCCATAGG 3M-^R),R1 (5M-^R CCAGTTCCTCCCTCAGCACAG 3M-^R) and R2 (5M-^R CCAGTAAGAGTGAGGTCCAGAC 3M-^R). The WT Prss16 allele was visualized as a 600 bp fragment using the F-R1 pair ofprimers, whereas the mutant allele was visualized as a 447 bp fragment using the F-R2 pair of primers. Absence of mRNA expression in the thymus of Prss16-/- mice was confirmed by northern-blot using a cDNA probe (data not shown). The Prss16 deficient mice were crossed onto a C57BL/6 background for eightgenerations and the thymi of the resulting mice were used for analysis.

2010-08-31 | E-MEXP-2829 | biostudies-arrayexpress

4C-seq experiment on mouse skeletal muscle and DP thymocytes

Project description:Purpose: The aim of this study is to investigate enhancer promoter interactions in skeletal muscle Methods: 50 ng of purified DNA were used as a template for PCR with bait-specific primers (Table S5) containing Illumina adapter termini. PCR reactions were pooled and, after primer removal with 1.8x AMPure XP beads, DNA was sequenced with the HiSeq 4000 (Illumina), as single-end 50 bp reads. Sequences were trimmed to remove primer and bait fragment sequence with the sabre tool (https://github.com/najoshi/sabre), mapped to the genome with Bowtie and converted to restriction fragment space as in van de Werken et al., 2012 (van de Werken et al., 2012). Interactions were called on single 4C experiments with peakC (Geeven et al., 2018), using a sliding window of 21 fragments.

2020-10-01 | GSE142516 | GEO

Protein binding to PDCD4 promoter X-box in Nutlin-3a treated U2OS cells

Project description:Human PDCD4 wild-type (wt) promoter fragments were amplified from U2OS genomic DNA and X-box deletion mutants (mut) were generated using the QuikChange site-directed mutagenesis kit (Agilent Technologies). DNA probes for affinity purification with the same sequences were obtained by PCR using a biotinylated primer for labeling the 3' end (Thermo Fisher Scientific). DNA affinity purification with nuclear extracts from Nutlin-3a treated U2OS cells.

2024-08-08 | PXD020932 | Pride

Molecular insight into the Lin28R192G mutation in human ESCs

Project description:Total RNA-seq analyses for the differentially expressed genes (DEGs) among WT (c42), Lin28 R192G hetero mut hESC (c26_5), and Lin28 R192G homo mut hESC (c38) To gain further molecular insight into the observed Lin28R192G mutation in human ESCs, we performed total RNA-sequencing (RNA-seq) analysis of the WT, Lin28 R192G hetero mut hESC, and Lin28 R192G homo mut hESC. The genes that are differentially expressed (DEGs) in Lin28 R192G hetero mut and Lin28 R192G homo mut hES compared to WT hESC.

2019-08-20 | GSE135994 | GEO

ATACseq in T. brucei wild-type and histone variant deletion cell lines.

Project description:3x107 cells were harvested and washed in 30 ml cold 1x TDB. The pellet was resuspended in 300 µl permeabilization buffer with protease inhibitors, 3 µl of 4 mM digitonin was added and incubated for 5 minutes at RT. The cells were pelleted, resuspended in 600 µl isotonic buffer with protease inhibitors and split in two samples, containing 1x107 and 2x107 cells, respectively. The transposition reaction was performed by adding 50 µl of transposition mix to the pellet (25 µl TD (2x reaction buffer from Nextera kit), 25 µl TDE1 (Tn5 transposase from Nextera kit), 22.5 µl nuclease-free water) and incubation for 30 minutes at 37 °C. For the gDNA control, 200 ng of gDNA was treated in the same manner. The DNA samples were purified using Qiagen MinElute PCR Purification Kit and eluted in 10 µl EB (10 mM Tris-HCl, pH 8). The transposed DNA fragments were amplified using the NEBNext® High-Fidelity 2X PCR Master Mix (M0541) supplied with 2.5 µl of 25 µM barcoded primers and amplification for 13 cycles. The libraries were purified using AMPure XP beads (Beckman Coulter) following the manufacturer’s instructions. The library fragment sizes between 150 and 1000 bp were purified from a 6% polyacrylamide gel. Paired-end 76 bp sequencing was carried out using the Illumina NextSeq system with a mid-output NextSeq 500/550 kit according to the manufacturer’s instructions.

2018-08-24 | GSE118902 | GEO

Laser-capture microdissection and RNA sequencing of aleurone and starchy endosperm of maize R1 genotypes

Project description:Three homozygous R1 genotypes, R1-g (WT), R1-sc and r1-m3 were laser microdissected and sequenced. The data showed that in aleurone (AL), expression of R1 in R1-sc and r1-m3 is higher than R1-g, and R1 is ectopically expressed in starchy endosperm (SE) in R1-sc and r1-m3. Interestingly, the ectopic expression of R1 in SE may be associated with RNA splicing process.

2022-07-21 | GSE200905 | GEO

Tet1 regulates embryonic stem cell differentiation programs and development independent of its catalytic activity.

Project description:In this study: (1) we characterized the Tet1 non-catalytic functions in the regulation of ESC gene expression programs by performing transcriptomic analysis of Tet1 wild type (WT), Tet1 catalytic mutant (Mut) and Tet1 knockout (KO) mouse ESCs by RNA-seq to identify differentially expressed genes. (2) We mapped the genome-wide occupancy of endogenously FLAG-tagged Tet1-WT and Tet1-Mut in ESCs by CUT&Tag using a specific antibody against FLAG. (3) We determined how the genome-wide occupancy of the epigenetic modifiers: Ezh2, Sin3a, Chd4 and the enrichment of histone marks: H3K27me3, H3K4me3 and H3K27ac, are affected in Tet1-KO ESCs versus Tet1-WT and Tet1-Mut by CUT&Tag or CUT&RUN. (4) We analyzed methylation levels and distribution in Tet1-WT, Tet1-Mut and Tet1-KO ESCs by WGBS, to confirm Tet1 non-catalytic targets with no differential methylation. (5) We explored whether Tet1 non-catalytic functions play a role in chromatin accessibility by performing ATAC-seq in Tet1-WT, Tet1-Mut and Tet1-KO ESCs.

2022-01-25 | GSE176389 | GEO

Watanabe2018_State Transition Model with Treatment and Costs

Project description:Model with functions depending on Age, Male, BP (Blood Pressure). There are 3 disease states: Healthy, Sick, and Dead, where the Dead state is terminal. The yearly transition probabilities are: Healthy to Dead: Age/1000; Healthy to Sick: According to function F1 depending on Age and Male and BP; Sick to Healthy: 0.1; Sick to Dead: according to function F2 depending on Age and Male. Pre-Transition Rules: Age increased by 1 and BP by Age/10 each simulation cycle. Post-Transition Rules: Treatment = BP>140 , becomes 1 when BP crosses 140 threshold; BP =BP-Treatment*10 , meaning a drop of 10 once treatment is applied; CostThisYear = Age + \Treatment*10 , cost depends on age and if treatment was taken; Cost= Cost + CostThisYear , it accumulates cost over time. Initial conditions: Healthy = (50 Male, 50 Female with Age =1,2,...,50 for each individual), BP =120, Sick = (0,0) and Dead = (0,0). Output: Number of men and women in each disease state for years 1-10 and their ages and costs in each state. A stratified report by male and female and young – up to age 30 and old above age 30 is produced.

2019-01-30 | MODEL1803120006 | BioModels

microRNA profiling of murine wt and MyD88-/- deficient bone marrow derived macrophages upon infection with Legionella Pneumophila

Project description:wt and MyD88-/- murine bone marrow derived macrophages were infected with Legionella Pneumophila for 24h. RNA was isolated by phenol/chloroform precipitation. 400 ng RNA per sample were then reverse transcribed with the Life Technologies miR RT kit with megaplex primers. Reverse transcribed RNA was then loaded on the rodent Taqman Low Density Array (TLDA) Cards and run according to manufacturer´s recommendations

2017-06-12 | GSE92600 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data