Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Nucleotide metabolism in cancer cells fuels a UDP-driven macrophage cross-talk promoting immunosuppression and immunotherapy resistance [RNAseq_Panc02_sgNT_sgCda_invitro]

ABSTRACT: Purpose: To study the effects of CDA depletion on PancO2 cell line. Here, we used RNA sequencing to understand if sgCda can alter cancer cell immunogenicity by looking at mutational burden. Methods: PancO2 cancer cells were transduced with a doxycycline-inducible Cas9 nuclease (Edit-R Inducible Lentiviral Cas9, Dharmacom) and selected with blasticidin (Bio-Connect). Cells expressing the doxycycline-inducible Cas9 nuclease were transduced with a target specific gRNA for CDA and a control non-targeting NT gRNA, and selected with puromycin (Sigma-Aldrich). After selection, cells were treated for seven days with or without doxycycline (2.5ug/mL, Sigma-Aldrich) to induce Cas9 expression and grown for seven more days without doxycycline before being used. Then RNA was isolated using TRIzol (Life Technologies). Starting from total RNA, poly-adenylated fragments were isolated, reverse transcribed and converted into indexed sequencing libraries using the KAPA stranded mRNA-seq kit (Sopachem, Eke, Belgium). The first 50 bases of these libraries were sequenced on a HiSeq 2500 system (Illumina, San Diego, CA). These raw reads were mapped after removal of the sequencing adapters to the reference transcriptome and genome (GRCm38/mm10) using the Bowtie TopHat pipeline (Langmead and Salzberg, 2012). Mapped reads were assigned to ensemble gene IDs by HTSeq. Variants were identified following GATK's best practice and only variants unique in one sample were retained. Results. Mapped reads were on average 35,159,030 ± 6,605,340 assigned counts per sample and 1,132 ± 266 mutations.

ORGANISM(S): Mus musculus

PROVIDER: GSE196787 | GEO | 2024/03/28

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Expression Profiles of HepG2 cells treated with following compounds: Azathriopine, Furan, Tetradecanoyl phorbol acetate, Tetrachloroethylene, Diazinon and Dmannitol

Project description:The transcriptomic changes induced in the human liver cell line HepG2 by Azathriopine (250µM, Sigma-Aldrich), Furan (2mM, Sigma-Aldrich), Tetradecanoyl phorbol acetate (500nM, Sigma-Aldrich), Tetrachloroethylene (2mM, Sigma-Aldrich), Diazinon (250µM, Sigma-Aldrich) and Dmannitol (250µM, Sigma-Aldrich) during 4, 8, 24, 48 and 72hrs As a solvent control for Azathriopine, Furan, Diazinon and Tetradecanoyl phorbol acetate, DMSO was used (0.5%); As a solvent control for tetrachloroethylene, ethanol was used (0.5%); As a solvent control for D-mannitol, HBSS was used (0.5%)

2015-01-13 | GSE58235 | GEO

Gene expression profile of doxycycline inducible shHNF4G hairpins in 22RV1 prostate cancer cells

Project description:To determine genes regulated by HNF4G, we performed doxycycline induced shRNA mediated knockdown of HNF4G using two lentiviral constructs as well as a scrambled shRNA in duplicate. Two pLKO.1 constructs against HNF4G (HNF4Gsh1: TRCN0000019243, targeting CACCAGCATCTCTCCAAACAA in coding DNA sequence (CDS); and HNF4Gsh2: TRCN0000420190, targeting GATGAGCTGGTTAGACCATTTC in CDS) were purchased from Sigma Aldrich MISSION® shRNA Plasmid DNA and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after doxycycline treatment and gene expression profiling was performed.

2017-11-01 | GSE85242 | GEO

Next Generation Sequencing analysis of KSHV lytic replication in TREx-BCBL1-RTA cells

Project description:Purpose: miR-Seq was utilised to identify miRNAs which are altered during the course of KSHV lytic replication at 0, 16 and 24 hours post reactivation in TREx-BCBL1-RTA cells. Methods: Virus lytic replication was induced via addition of 2 µg/mL doxycycline hyclate (Sigma-Aldrich). Total RNA was extracted from TREx-BCBL-1s at 0, 16 and 24 hours post lytic induction. Small RNA libraries were prepared using the TruSeq Small RNA Library Prep Kit (Illumina). Quality filtered (Q < 20), and adapter trimmed reads (Trimmomatic v0.39) [59] were aligned to the GRCh38/hg38 assembly of the human genome using Bowtie2 (V 2.4.2).

2022-02-09 | GSE186652 | GEO

Potential interactors of NLRP3 in NLRP3-inducible THP-1 cells treated with LPS

Project description:The NLRP3-inducible THP-1-cell line was generated by introducing Flag-WT NLRP3 into NLRP3 KO THP-1 cells through a tetracycline (Tet) responsive element (TRE) promoter (Tet-On) lentiviral infection system. Cells were treated with doxycycline (Dox, 200 ng/mL, Sigma-Aldrich, cat# D9891) for 18 h to induce the expression of Flag-NLRP3 in THP-1-derived macrophages, followed by treatment with lipopolysaccharide (LPS, 200 ng/ml, Sigma-Aldrich, cat# L4524) for 3 h. We used the cells without doxycycline treatment as a negative control and mixed the cells from three individual flasks for mass spectrometry. The cells were collected in low-salt lysis buffer (50 mM Tris-HCl (GCRF, China), pH 8.0, 150 mM NaCl (GCRF, China), 1 mM EDTA (Vetec), 1 mM DTT (Sigma-Aldrich) and 0.5% IGEPAL CA630 (Sigma-Aldrich) containing phosphatase inhibitor (Roche) and EDTA-free protease inhibitor (Biosharp)) and incubated on a rocker with ice for 30 min and centrifuged at 12000 g/4 °C for 15 min to obtain cell lysates. The cell lysates were immunoprecipitated with an anti-Flag antibody. The beads were washed three times with low-salt lysis buffer, separated by SDS-PAGE, and then stained with Coomassie Blue. The entire lane was excised and digested with trypsin at 37 °C for 20 h. The enzymatic hydrolysis product was desalted, lyophilized and redissolved in 0.1% FA solution for chromatography-tandem mass spectrometry (LC-MS/MS) identification of peptide mixtures at Applied Protein Technology (aptbiotech, Inc. Shanghai, China) with a Q Exactive mass spectrometer (Thermo Fisher, California, USA). RAW files generated from the spectrometer were subjected to Proteome Discoverer 1.4 software for protein identification.

2022-11-18 | PXD038215 |

Exploring the gene expression profile upon FXR1 knockdown in H358 cells using RNA-seq

Project description:We performed the RNA-seq in control samples and FXR1 knockdown samples, and compared the gene expression profiles to explore the effect of FXR1 knockdown on gene expression. The study was performed in H358 cells. Doxycycline inducible shRNA3 (sh3) was used to knockdown FXR1. Control shRNA (ctrl) samples were used to get rid of the effect of Doxycycline treatment. Both the Doxycycline treament for 3 days (D3) and 5 days (D5) samples were collected. Each sample has three repeats (rep 1, rep 2, and rep 3). The mRNA profiles were generated by deep sequencing using Illumina.Sequenced reads were trimmed for adaptor sequence, then mapped to hg19 whole genome using STAR v2.5.3 with parameters --bamRemoveDuplicatesType UniqueIdentical --outSAMmultNmax 1. Raw reads and Reads Per Kilobase per Megabase of library size (RPKM) were calculated using HOMER (PMID: 20513432). Differential gene expression was analyzed using R package DESeq2 using the raw reads.

2017-10-04 | GSE101754 | GEO

Homo sapiens

Project description:Whole Exome Sequencing of Doxycycline-Inducible Cas9-harboring HEK293

| PRJNA557186 | ENA

Induced MIST1 and PTF1a Expression in Pancreatic Ductal Adenocarcinoma Cells

Project description:Purpose: The goal of the study was to determine the effects of forced expression of the acinar transcription factors MIST1 and PTF1a in PDAC cells. Methods: Doxycycline inducible MIST1myc and PTF1amyc Panc-1 cells were generated using Clontech's Tetone System and subjected to RNA-Sequencing following doxycycline treatment. Results: 50 million sequence reads were mapped to the human genome. Data suggests acinar associated molecules were induced upon doxycyline treatment. Conclusions: MIST1 and PTF1a retain functional activity and can promote acinar gene expression in the context of pancreatic cancer cells.

2018-10-27 | GSE106290 | GEO

LIN28A modulates splicing and gene expression programs in breast cancer cells [RIP-Seq]

Project description:The goals of this study were to identify LIN28 downstream gene targets in breast cancer cells. We use a subclone of the MCF-7 breast cancer cell line, MCF-7M as our model system. Methods: mRNA-protein complexes (mRNP) lysates were prepared from MCF-7M cells and incubated with Protein-A Sepharose beads (Sigma-Aldrich) and either LIN28 (Abcam) or control normal rabbit serum IgG antibodies. LIN28 interacting mRNAs were identified by whole genome sequencing. Results: Using an optimized data analysis workflow, we mapped approximately 13 million sequence reads for LIN28-IP and CTL- IP (IgG), respectively to the to the human genome (build h19). Conclusions: mRNA were significantly bound by LIN28 if LIN28 RIP had 2.5 fold increase in normalized reads compared to IgG. We found that LIN28 was predominantly bound at coding exons and 3'UTRs, 38% & 45% respectively, in the 843 mRNAs within MCF-7M genome.

2015-07-27 | GSE71009 | GEO

Metformin on human macrophages

Project description:Metformin on human macrophages Human blood derived macrophages were treated with 10micromolar Metformin (Sigma-Aldrich) for 4h

2020-06-27 | GSE153318 | GEO

Effect of LXR agonist T0901317 on the intestinal transcriptome in mice.

Project description:Mice were treated for three days by oral gavage with the synthetic LXR ligand T0901317 (Cayman chemical, USA) using a dose of 50 mg/kg/day in vehicle (0.5% Carboxy-methylcellulose; 400 cPs (Sigma-Aldrich, USA); 0.2% Tween80 (Sigma-Aldrich, USA)) or solely the vehicle (control group). Mice were anesthetized with isoflurane and euthanized by cardiac puncture followed by cervical dislocation. Intestines were flushed with ice cold PBS and frozen in liquid nitrogen.

2020-10-27 | GSE110528 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data