Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Gene expression profile of doxycycline inducible shHNF4G hairpins in 22RV1 prostate cancer cells

ABSTRACT: To determine genes regulated by HNF4G, we performed doxycycline induced shRNA mediated knockdown of HNF4G using two lentiviral constructs as well as a scrambled shRNA in duplicate. Two pLKO.1 constructs against HNF4G (HNF4Gsh1: TRCN0000019243, targeting CACCAGCATCTCTCCAAACAA in coding DNA sequence (CDS); and HNF4Gsh2: TRCN0000420190, targeting GATGAGCTGGTTAGACCATTTC in CDS) were purchased from Sigma Aldrich MISSION® shRNA Plasmid DNA and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after doxycycline treatment and gene expression profiling was performed.

ORGANISM(S): Homo sapiens

PROVIDER: GSE85242 | GEO | 2017/11/01

SECONDARY ACCESSION(S): PRJNA337940

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes.

2013-05-10 | GSE46329 | GEO

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

2013-05-10 | E-GEOD-46329 | biostudies-arrayexpress

Gene expression profile of 22RV1 prostate cancer cells upon SPINK1 knockdown

Project description:Serine Peptidase Inhibitor, Kazal type 1 (SPINK1) overexpression represents the second-largest prostate cancer (PCa) subtype associated with increased risk of biochemical recurrence and poor prognosis. To determine the pathways regulated by SPINK1 in 22RV1 prostate cancer cells, we performed shRNA mediated knockdown of SPINK1 using lentiviral constructs. Scrambled shRNA was used as a control. pGIPZ constructs against SPINK1 (shSPINK1-1, shSPINK1-2, shSPINK1-3) and control shScrambled construct were purchased from Dharmacon.

2019-12-16 | GSE124345 | GEO

RNAseq analysis of USP7 knockdown in MM16 and MM27 metastatic melanoma PDX cells

Project description:Purpose: Study of transcriptomic changes upon depletion of USP7 Methods: Melanoma PDX cells were transduced with lentiviral vectors expressing Scrambled(shSCR) or USP7 targeting (shUSP7) shRNA

2022-08-24 | GSE180986 | GEO

Transcriptomic analysis of APC knock down HCEC 1CT cells compared to the wild type HCEC 1CT cells.

Project description:In order to investigate sophisticated events during cancer initiation, we established early colorectal cancer development model. We performed scRNA-seq and analyzed the scRNA-seq dataset. scRNA-seq was conducted at 3- and 7-days after transduction of shRNA targeting APC (shAPC) and scrambled shRNA (shScr) on HCEC 1CT cells.

2020-09-25 | GSE152745 | GEO

Individual SRC-2 and SRC-3 knock-down in MCF-7 cells

Project description:Experimental aim: identification of SRC-2 and SRC-3-related genes in MCF-7 breast cancer cells. Experimental workflow: 1. shRNA transduction. MCF-7 cells were transduced with a mix of lentiviral particles containing five individual lentiviral pLKO.1-puro short hairpin (sh) RNA plasmids targeting different sequences on SRC-2 or SRC-3 mRNA and a pLKO.1-puro empty vector control. The puromycin selections were maintained for three weeks to obtain cells containing stably integrated shRNA. 2. Sample preparation. RNA was extracted from eight independent replicates expressing the pLKO.1-puro empty shRNA vector (shKTR), from eight replicates of SRC-2 shRNA expressing cells (shSRC-2), and from seven replicates of SRC-3 shRNA expressing cells (shSRC-3). 300 ng of total RNA from each cell sample was biotin-labelled and amplified.

2019-07-01 | E-MTAB-7018 | biostudies-arrayexpress

RNA-seq analysis of K562 cells (K562-shX) with stable integration of a tet-inducible shRNA targeting a candidate (X) transcription factor from ENCODE/HudsonAlpha-MyersLab

Project description:K562-shX cells are made in an effort to validate TFBS data and ChIP-seq antibodies in Myers lab (GSE32465). K562 cells are transduced with lentiviral vector having Tet-inducible shRNA targeting a transcription factor gene. Cells with stable integration of shRNA constructs are selected using puromycin in growth media. Doxycycline is added to the growth media to induce the expression of shRNA and a red fluorescent protein marker. A successful shRNA cell line shows at least a 70% reduction in expression of the target transcription factor as measured by qPCR. For identification, we designated these cell lines as K562-shX, where X is the transcription factor targeted by shRNA and K562 denotes the parent cell line. For example, K562-shATF3 cells are K562 derived cells selected for stable integration of shRNA targeting the transcription factor ATF3 gene and showed at least a 70% reduction in the expression of ATF3 gene when measured by qPCR. Cells growing without doxycycline (uninduced) are used as a control to measure the change in expression of target transcription factor gene after induction of shRNA using doxycycline. For detailed growth and culturing protocols for these cells please refer to http://hudsonalpha.org/sites/default/files/pdf/shRNA%20K562%20protocol.pdf. To identify the potential downstream targets of the candidate transcription factor, analyze the mRNA expression profile of the uninduced and induced K562-shX using RNA-seq. For data usage terms and conditions, please refer to http://www.genome.gov/27528022 and http://www.genome.gov/Pages/Research/ENCODE/ENCODEDataReleasePolicyFinal2008.pdf

2011-12-01 | GSE33816 | GEO

RNA-seq analysis of K562 cells (K562-shX) with stable integration of a tet-inducible shRNA targeting a candidate (X) transcription factor from ENCODE/HudsonAlpha-MyersLab

2011-12-01 | E-GEOD-33816 | biostudies-arrayexpress

KDM4A depletion by siRNA in HEK293T cells

Project description:The goal of this study was to determine genes affected by depletion of KDM4A in HEK293T cells This data was used in Van Rechem et. al. Cancer Discovery 2014 to demonstrate that depletion of KDM4A did not alter expression of genese associated with translation. The experiment uses two different shRNA constructs; shKDM4A.2 in a pSuper backbone and shKDM4A.6 in a pLKO backbone. A corresponding empty vector control was conducted for each backbone. Each shRNA was compared to its own control.

2015-03-31 | E-GEOD-63812 | biostudies-arrayexpress

Identification of TEAD4 target genes in colorectal cancer cells

Project description:We have identified TEAD4 as a key prognosis factor in colorectal cancer. To elucidate the potentail mechanism and function of TEAD4 in colorectal caner, we generated two stable cell lines expressing different shRNA targeting TEAD4 in the mesenchymal-like LoVo cells and the differential genes were detected by microarray. LoVo colorectal cancer cells stably expressing pLKO.1 control shRNA or sh1_shTEAD4 or sh2_shTEAD4

2014-01-01 | E-GEOD-53063 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data