A de novo transcription-dependent TAD boundary underpins critical multiway interactions during antibody class switch recombination [Tri-C]
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
PROVIDER: GSE198179 | GEO | 2023/01/20
REPOSITORIES: GEO
Similar Datasets
Project description:Antibody class switch recombination (CSR) requires the ligation of DNA breaks in transcribed and juxtaposed donor and acceptor switch (S) sequences (S-S synapsis) spaced 50-200 kb apart within the immunoglobulin heavy chain locus (Igh). CSR is believed to occur via the association of active S regions with the 3’ regulatory region (3’RR) super-enhancer thereby coupling transcription with S-S synapsis. Here, we map the multi-way interactome underlying CSR using Tri-C. Surprisingly, S-S synapsis is strongly associated with the 3` CTCF binding element (3`CBE), but not the 3’RR, a finding also confirmed by Micro-C measurements. Instead, the 3’RR forms a self-interacting domain independently engaging with Igh genes. Additionally, transcription at acceptor S regions creates a topological barrier that insulates S-S synapsis from loop extrusion complexes. Thus, Igh gene activation and S-S synapsis occur via distinct topological states created by the interaction between transcription and the loop extrusion machinery.
2023-01-20 | GSE198181 | GEO
Project description:Antibody class switch recombination (CSR) requires the ligation of DNA breaks in transcribed and juxtaposed donor and acceptor switch (S) sequences (S-S synapsis) spaced 50-200 kb apart within the immunoglobulin heavy chain locus (Igh). CSR is believed to occur via the association of active S regions with the 3’ regulatory region (3’RR) super-enhancer thereby coupling transcription with S-S synapsis. Here, we map the multi-way interactome underlying CSR using Tri-C. Surprisingly, S-S synapsis is strongly associated with the 3` CTCF binding element (3`CBE), but not the 3’RR, a finding also confirmed by Micro-C measurements. Instead, the 3’RR forms a self-interacting domain independently engaging with Igh genes. Additionally, transcription at acceptor S regions creates a topological barrier that insulates S-S synapsis from loop extrusion complexes. Thus, Igh gene activation and S-S synapsis occur via distinct topological states created by the interaction between transcription and the loop extrusion machinery.
2023-01-20 | GSE198180 | GEO
Project description:Antibody class switch recombination (CSR) requires the ligation of DNA breaks in transcribed and juxtaposed donor and acceptor switch (S) sequences (S-S synapsis) spaced 50-200 kb apart within the immunoglobulin heavy chain locus (Igh). CSR is believed to occur via the association of active S regions with the 3’ regulatory region (3’RR) super-enhancer thereby coupling transcription with S-S synapsis. Here, we map the multi-way interactome underlying CSR using Tri-C. Surprisingly, S-S synapsis is strongly associated with the 3` CTCF binding element (3`CBE), but not the 3’RR, a finding also confirmed by Micro-C measurements. Instead, the 3’RR forms a self-interacting domain independently engaging with Igh genes. Additionally, transcription at acceptor S regions creates a topological barrier that insulates S-S synapsis from loop extrusion complexes. Thus, Igh gene activation and S-S synapsis occur via distinct topological states created by the interaction between transcription and the loop extrusion machinery.
2023-01-20 | GSE198176 | GEO
Project description:In a B lymphocyte immunoglobulin heavy chain locus (IgH), a developmentally assembled V(D)J exon encoding an antibody variable region lies upstream of exons encoding a m constant region (Cm), allowing generation of mIgH chain transcripts and IgM-class antibodies1. Mouse IgH class switch recombination (CSR) replaces Cmwith one of 6 sets of constant region exons (CHs) that lie 100-200kb downstream1. Each CH is flanked upstream by a promoter, non-coding I-exon, and long repetitive switch (S) region1,2. Cytokines/activators induce specific I-promoter transcription and activation-induced cytidine deaminase (AID)2,3. AID is transcriptionally-targeted to initiate DNA breaks in Sm and activated downstream acceptor S regions, which are joined in deletional orientation to complete CSR4,5. 3’IgH regulatory region (3’IgHRR) enhancers control upstream I promoters and, thereby, CSR via linear competition involving I promoter/3’IgHRR interactions6-11. Here, we report that synapsis of regulatory elements, S regions and DSBs for CSR is achieved by chromatin loop extrusion. In naive B cells, 3’IgHRR enhancers and adjacent 3’IgH CTCF-binding elements (CBEs) interact via loop extrusion with the upstream Igh intronic enhancer (iEm)/Sm locale to generate dynamic 200kb 3’Igh basal loop. In CSR-activated B cells, induced transcription from I-promoters within this basal loop generates dynamic sub-loops that directionally align Sm and target S regions near the 3’IgHRR for CSR. In CH12F3 B lymphoma cells, inactivation of the constitutively active Ia-promoter abrogates looping and CSR to Sa, while activating transcription, looping, and CSR to upstream S regions. CBEs inserted upstream of Ia in convergent orientation with 3’IgH CBEs generate sub-loops that activate inversional Sa CSR. In I-promoter-deleted CH12F3 cells, this ectopic CBE-based sub-loop inactivates upstream S region CSR, while transcriptionally activating non-S region sequences adjacent to the inserted CBEs for S synapsis and CSR. Together, our findings implicate chromatin loop extrusion in the “unprecedented mechanism”5 by which Igh organization in cis promotes orientation-specific CSR DSB joining.
2019-09-25 | GSE130266 | GEO
Project description:In a B lymphocyte immunoglobulin heavy chain locus (IgH), a developmentally assembled V(D)J exon encoding an antibody variable region lies upstream of exons encoding a constant region (C), allowing generation of IgH chain transcripts and IgM-class antibodies1. Mouse IgH class switch recombination (CSR) replaces Cwith one of 6 sets of constant region exons (CHs) that lie 100-200kb downstream1. Each CH is flanked upstream by a promoter, non-coding I-exon, and long repetitive switch (S) region1,2. Cytokines/activators induce specific I-promoter transcription and activation-induced cytidine deaminase (AID)2,3. AID is transcriptionally-targeted to initiate DNA breaks in S and activated downstream acceptor S regions, which are joined in deletional orientation to complete CSR4,5. 3’IgH regulatory region (3’IgHRR) enhancers control upstream I promoters and, thereby, CSR via linear competition involving I promoter/3’IgHRR interactions6-11. Here, we report that synapsis of regulatory elements, S regions and DSBs for CSR is achieved by chromatin loop extrusion. In naive B cells, 3’IgHRR enhancers and adjacent 3’IgH CTCF-binding elements (CBEs) interact via loop extrusion with the upstream Igh intronic enhancer (iE)/S locale to generate dynamic 200kb 3’Igh basal loop. In CSR-activated B cells, induced transcription from I-promoters within this basal loop generates dynamic sub-loops that directionally align S and target S regions near the 3’IgHRR for CSR. In CH12F3 B lymphoma cells, inactivation of the constitutively active I-promoter abrogates looping and CSR to S, while activating transcription, looping, and CSR to upstream S regions. CBEs inserted upstream of I in convergent orientation with 3’IgH CBEs generate sub-loops that activate inversional S CSR. In I-promoter-deleted CH12F3 cells, this ectopic CBE-based sub-loop inactivates upstream S region CSR, while transcriptionally activating non-S region sequences adjacent to the inserted CBEs for S synapsis and CSR. Together, our findings implicate chromatin loop extrusion in the “unprecedented mechanism”5 by which Igh organization in cis promotes orientation-specific CSR DSB joining.
2019-09-25 | GSE130265 | GEO
Project description:In a B lymphocyte immunoglobulin heavy chain locus (IgH), a developmentally assembled V(D)J exon encoding an antibody variable region lies upstream of exons encoding a constant region (C), allowing generation of IgH chain transcripts and IgM-class antibodies1. Mouse IgH class switch recombination (CSR) replaces Cwith one of 6 sets of constant region exons (CHs) that lie 100-200kb downstream1. Each CH is flanked upstream by a promoter, non-coding I-exon, and long repetitive switch (S) region1,2. Cytokines/activators induce specific I-promoter transcription and activation-induced cytidine deaminase (AID)2,3. AID is transcriptionally-targeted to initiate DNA breaks in S and activated downstream acceptor S regions, which are joined in deletional orientation to complete CSR4,5. 3’IgH regulatory region (3’IgHRR) enhancers control upstream I promoters and, thereby, CSR via linear competition involving I promoter/3’IgHRR interactions6-11. Here, we report that synapsis of regulatory elements, S regions and DSBs for CSR is achieved by chromatin loop extrusion. In naive B cells, 3’IgHRR enhancers and adjacent 3’IgH CTCF-binding elements (CBEs) interact via loop extrusion with the upstream Igh intronic enhancer (iE)/S locale to generate dynamic 200kb 3’Igh basal loop. In CSR-activated B cells, induced transcription from I-promoters within this basal loop generates dynamic sub-loops that directionally align S and target S regions near the 3’IgHRR for CSR. In CH12F3 B lymphoma cells, inactivation of the constitutively active I-promoter abrogates looping and CSR to S, while activating transcription, looping, and CSR to upstream S regions. CBEs inserted upstream of I in convergent orientation with 3’IgH CBEs generate sub-loops that activate inversional S CSR. In I-promoter-deleted CH12F3 cells, this ectopic CBE-based sub-loop inactivates upstream S region CSR, while transcriptionally activating non-S region sequences adjacent to the inserted CBEs for S synapsis and CSR. Together, our findings implicate chromatin loop extrusion in the “unprecedented mechanism”5 by which Igh organization in cis promotes orientation-specific CSR DSB joining.
2019-09-25 | GSE130264 | GEO
Project description:In a B lymphocyte immunoglobulin heavy chain locus (IgH), a developmentally assembled V(D)J exon encoding an antibody variable region lies upstream of exons encoding a m constant region (Cm), allowing generation of mIgH chain transcripts and IgM-class antibodies1. Mouse IgH class switch recombination (CSR) replaces Cmwith one of 6 sets of constant region exons (CHs) that lie 100-200kb downstream1. Each CH is flanked upstream by a promoter, non-coding I-exon, and long repetitive switch (S) region1,2. Cytokines/activators induce specific I-promoter transcription and activation-induced cytidine deaminase (AID)2,3. AID is transcriptionally-targeted to initiate DNA breaks in Sm and activated downstream acceptor S regions, which are joined in deletional orientation to complete CSR4,5. 3’IgH regulatory region (3’IgHRR) enhancers control upstream I promoters and, thereby, CSR via linear competition involving I promoter/3’IgHRR interactions6-11. Here, we report that synapsis of regulatory elements, S regions and DSBs for CSR is achieved by chromatin loop extrusion. In naive B cells, 3’IgHRR enhancers and adjacent 3’IgH CTCF-binding elements (CBEs) interact via loop extrusion with the upstream Igh intronic enhancer (iEm)/Sm locale to generate dynamic 200kb 3’Igh basal loop. In CSR-activated B cells, induced transcription from I-promoters within this basal loop generates dynamic sub-loops that directionally align Sm and target S regions near the 3’IgHRR for CSR. In CH12F3 B lymphoma cells, inactivation of the constitutively active Ia-promoter abrogates looping and CSR to Sa, while activating transcription, looping, and CSR to upstream S regions. CBEs inserted upstream of Ia in convergent orientation with 3’IgH CBEs generate sub-loops that activate inversional Sa CSR. In I-promoter-deleted CH12F3 cells, this ectopic CBE-based sub-loop inactivates upstream S region CSR, while transcriptionally activating non-S region sequences adjacent to the inserted CBEs for S synapsis and CSR. Together, our findings implicate chromatin loop extrusion in the “unprecedented mechanism”5 by which Igh organization in cis promotes orientation-specific CSR DSB joining.
2019-09-25 | GSE130263 | GEO
Project description:Class Switch Recombination (CSR) is a DNA recombination reaction that diversifies the effector component of antibody responses. CSR is initiated by activation-induced cytidine deaminase (AID), which targets transcriptionally active immunoglobulin heavy chain (Igh) switch donor and acceptor DNA. The 3’ Igh super-enhancer, 3’ Regulatory Region (3’RR), is essential for acceptor region transcription, but how this function is regulated is unknown. Here we identify the chromatin reader ZMYND8 as an essential regulator of the 3’RR and CSR. In B cells, ZMYND8 binds promoters and super-enhancers, including the 3’RR, and controls its activity by modulating the enhancer transcriptional status. In its absence, there is increased 3’RR polymerase loading, and decreased acceptor region transcription and CSR. In addition to CSR, ZMYND8 deficiency impairs somatic hypermutation (SHM) of Igh, which is also dependent on the 3’RR. Thus ZMYND8 controls Igh diversification in mature B lymphocytes by regulating the activity of the 3’ Igh super-enhancer.
2018-10-04 | GSE118794 | GEO
Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR. 4C-seq data in resting and activated WT and Med1 mutant B cells. 4C bait was designed in the Eu enhancer of the Igh locus on chromosome 12. Primer sequences: 5â TCTGTCCTAAAGGCTCTGAGA 3â and 5â GAACACAGAAGTATGTGTATGGA 3â.
2016-02-17 | E-GEOD-62969 | biostudies-arrayexpress
Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR.
2016-02-17 | GSE62969 | GEO