Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

PTIP promotes chromatin changes critical for immunoglobulin class switch recombination

ABSTRACT: Programmed genetic rearrangements in lymphocytes require transcription at antigen receptor genes to promote accessibility for initiating double-strand break (DSB) formation critical for DNA recombination and repair. Here we show that activated B cells deficient in the PTIP component of the MLL3 (mixed-lineage leukemia 3) /MLL4 complex display impaired histone methylation (H3K4me3) and transcription initiation of downstream switch regions at the immunoglobulin heavy-chain (Igh) locus leading to defective immunoglobulin class-switching. We also show that PTIP accumulation at DSBs contributes to class-switch recombination (CSR) and genome stability independently from Igh switch transcription. These results demonstrate that PTIP promotes specific chromatin changes that control the accessibility of the Igh locus to CSR, and suggest a non-redundant role for the MLL3/MLL4 complex in altering antibody effector function.

ORGANISM(S): Mus musculus

PROVIDER: GSE20852 | GEO | 2010/08/25

SECONDARY ACCESSION(S): PRJNA124761

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

PTIP promotes chromatin changes critical for immunoglobulin class switch recombination

Project description:Programmed genetic rearrangements in lymphocytes require transcription at antigen receptor genes to promote accessibility for initiating double-strand break (DSB) formation critical for DNA recombination and repair. Here we show that activated B cells deficient in the PTIP component of the MLL3 (mixed-lineage leukemia 3) /MLL4 complex display impaired histone methylation (H3K4me3) and transcription initiation of downstream switch regions at the immunoglobulin heavy-chain (Igh) locus leading to defective immunoglobulin class-switching. We also show that PTIP accumulation at DSBs contributes to class-switch recombination (CSR) and genome stability independently from Igh switch transcription. These results demonstrate that PTIP promotes specific chromatin changes that control the accessibility of the Igh locus to CSR, and suggest a non-redundant role for the MLL3/MLL4 complex in altering antibody effector function. Genome-wide analysis of histone modifications, PTIP, and Pol II in PTIP-WT and PTIP-KO mouse activated B cells.

2010-08-25 | E-GEOD-20852 | biostudies-arrayexpress

A PTIP-PA1 subcomplex promotes transcription for IgH class-switching independently from the associated MLL3/MLL4 methyltransferase complex

Project description:Class-switch recombination (CSR) diversifies antibodies for productive immune responses while maintaining stability of the B cell genome. Transcription at the immunoglobulin heavy-chain (Igh) locus targets CSRassociated DNA damage and is promoted by the BRCT domain-containing PTIP protein. Although PTIP is a unique component of the MLL3/MLL4 chromatin-modifying complex, the mechanisms for how PTIP promotes transcription remain unclear. Here we dissect the minimal structural requirements of PTIP and its different protein complexes using quantitative proteomics in primary lymphocytes. We find that PTIP functions in transcription and CSR separately from its association with the MLL3/MLL4 complex and from its localization to sites of DNA damage. We identify a tandem BRCT domain of PTIP that is sufficient for CSR and identify PA1 as its main functional protein partner. Collectively, we provide genetic and biochemical evidence that a PTIP-PA1 subcomplex functions independently from the MLL3/MLL4 complex to mediate transcription during CSR. These results further our understanding of how multi-functional chromatin-modifying complexes are organized by subcomplexes that harbor unique and distinct activities. Genome-wide analysis of histone modifications in PA1-WT and -KO mouse activated B cells

2015-12-12 | E-GEOD-75930 | biostudies-arrayexpress

A PTIP-PA1 subcomplex promotes transcription for IgH class-switching independently from the associated MLL3/MLL4 methyltransferase complex

2015-12-12 | GSE75930 | GEO

Med1 facilitates transcriptional activation and dynamic long-range contacts at the IgH locus during class switch recombination.

Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR. 4C-seq data in resting and activated WT and Med1 mutant B cells. 4C bait was designed in the Eu enhancer of the Igh locus on chromosome 12. Primer sequences: 5â TCTGTCCTAAAGGCTCTGAGA 3â and 5â GAACACAGAAGTATGTGTATGGA 3â.

2016-02-17 | E-GEOD-62969 | biostudies-arrayexpress

Genome-wide localization of Smc1, Smc3 and CTCF in mouse B cells.

Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to switch regions and by the subsequent generation and resolution of dsDNA breaks (DSBs). During, CSR the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and switch regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we show that during CSR, AID associates with subunits of cohesin, a complex previously implicated in DNA repair and in the formation of DNA loops between enhancers and promoters. By ChIP-Seq experiments, we find that Cohesin is dynamically recruited to the IgH locus during CSR and that knockdown of Cohesin or its regulatory subunits results in impaired CSR and abnormal DSB resolution. Our results are consistent with a model in which Cohesin controls the formation of long-range DNA loops at the IgH locus and the resolution of DSBs generated during CSR. Smc1, Smc3 and CTCF were immunoprecipitated from resting or in vitro activated B cells.

2013-10-11 | E-GEOD-43594 | biostudies-arrayexpress

Med1 facilitates transcriptional activation and dynamic long-range contacts at the IgH locus during class switch recombination.

2016-02-17 | GSE62969 | GEO

Genome-wide localization of Smc1, Smc3 and CTCF in mouse B cells.

Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to switch regions and by the subsequent generation and resolution of dsDNA breaks (DSBs). During, CSR the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and switch regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we show that during CSR, AID associates with subunits of cohesin, a complex previously implicated in DNA repair and in the formation of DNA loops between enhancers and promoters. By ChIP-Seq experiments, we find that Cohesin is dynamically recruited to the IgH locus during CSR and that knockdown of Cohesin or its regulatory subunits results in impaired CSR and abnormal DSB resolution. Our results are consistent with a model in which Cohesin controls the formation of long-range DNA loops at the IgH locus and the resolution of DSBs generated during CSR.

2013-10-11 | GSE43594 | GEO

The superenhancer binding factor Med1 is broadly required for optimally expressing and hypermutating IgH genes as well as for terminating their expression through locus suicide recombination

Project description:Assembly, expression and maturation of the Immunoglobulin heavy (IgH) chain repertoire necessitates long-range 3D-interactions under regulation by the IgH locus Eµ and 3’ regulatory region (3’RR) super-enhancers. In progenitors, Eµ instrumentally supports VDJ recombination notably towards distal VH genes. In mature cells, the 3’RR first boosts the production of membrane-type IgH transcripts. It later attracts Activation-induced cytidine deaminase at three specific locations: VDJ genes undergoing somatic hypermutation (SHM), switch regions undergoing class switch recombination (CSR), and the 3’RR itself during locus suicide recombination (LSR). In plasma cells devoted to abundant Ig secretion, a late long-range effect is to promote high IgH transcription. The Mediator subunit Med1, which binds super-enhancers and has increased activity after phosphorylation by ERK, was previously attributed a role restricted to class-switched cells. We now show its broader impact on IgH expression, both by promoting recombination of distal VH genes in progenitors and by later supporting SHM. Med1-dependence also marks all long-range functions of the 3’RR, including not only intra- but also trans-chromosomal CSR, LSR, optimal BCR expression and the transcriptional boost featured by plasma cells. Altogether, Med1 appears as a major and specific actor of all the long-range tasks effected by the IgH locus super-enhancers beyond transcription.

2022-10-20 | GSE136845 | GEO

Acetylated Histone Reader Brd4 functions as Repair Adaptor in Immunoglobulin Class Switch Recombination

Project description:Class Switch Recombination (CSR) is a B cell specific genomic alteration induced by activation induced cytidine deaminase (AID)-dependent DNA break, followed by repair and recombination at the immunoglobulin heavy-chain locus. The involvement of several chromatin-associated factors in promoting AID-induced DNA break formation has been reported. However, the involvement of chromatin adaptors at the repair phase of CSR remains unknown. Here, we provide evidence that acetylated histone reader Brd4 is critical to the repair and recombination step of CSR. Brd4 was recruited to the AID-induced DNA break region, and depletion of Brd4 from the S region chromatin by knockdown or a chemical inhibitor JQ1 causes CSR impairment without affecting AID-induced DNA break generation. Such inhibition of Brd4 suppressed the accumulation of 53BP1 and UNG at the cleaved S regions, perturbed switch donor-switch acceptor microhomology length and reduced Igh/c-myc translocation. We conclude that Brd4 serves as a histone-reader platform required for the recruitment of CSR repair components.

2014-06-20 | GSE52239 | GEO

The Chromatin Reader ZMYND8 Regulates Igh Enhancers to Promote Immunoglobulin Class Switch Recombination

Project description:Class Switch Recombination (CSR) is a DNA recombination reaction that diversifies the effector component of antibody responses. CSR is initiated by activation-induced cytidine deaminase (AID), which targets transcriptionally active immunoglobulin heavy chain (Igh) switch donor and acceptor DNA. The 3’ Igh super-enhancer, 3’ Regulatory Region (3’RR), is essential for acceptor region transcription, but how this function is regulated is unknown. Here we identify the chromatin reader ZMYND8 as an essential regulator of the 3’RR and CSR. In B cells, ZMYND8 binds promoters and super-enhancers, including the 3’RR, and controls its activity by modulating the enhancer transcriptional status. In its absence, there is increased 3’RR polymerase loading, and decreased acceptor region transcription and CSR. In addition to CSR, ZMYND8 deficiency impairs somatic hypermutation (SHM) of Igh, which is also dependent on the 3’RR. Thus ZMYND8 controls Igh diversification in mature B lymphocytes by regulating the activity of the 3’ Igh super-enhancer.

2018-10-04 | GSE118794 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data