Transcriptomics

Dataset Information

0

Transcriptome expression changes after knockdown of ALDH1A1 in human colon cancer cells HT29


ABSTRACT: Firstly, shRNA (GCCAAATCATTCCTTGGAATT) was used to knock down ALDH1A1 in HT29 cells, and the knockdown effect was verified by western blot. Then the shALDH1A1 HT29 cells were compared with parental HT29 cells by RNA-seq.

ORGANISM(S): Homo sapiens

PROVIDER: GSE225822 | GEO | 2024/08/27

REPOSITORIES: GEO

Similar Datasets

2024-08-27 | GSE269935 | GEO
2009-01-01 | GSE14257 | GEO
2021-09-15 | GSE165875 | GEO
2021-09-08 | PXD012230 | Pride
2019-10-08 | GSE121043 | GEO
2021-12-06 | GSE123396 | GEO
2014-01-23 | E-GEOD-54298 | biostudies-arrayexpress
2023-07-19 | GSE226018 | GEO
2016-07-03 | E-GEOD-69573 | biostudies-arrayexpress
2016-01-01 | GSE69573 | GEO