Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Colon cancer HT29 cells: siHX transfected vs. control

ABSTRACT: HT29 cells were transsfected with siRNA (siHX), which is targeting the human endogeous retrovirus HERV-HX. Cells were harvested 72 h after transfection and knock-down of HERV-HX was evaluated by quantitative RT-PCR. Keywords: Genetic modification

ORGANISM(S): Homo sapiens

PROVIDER: GSE14257 | GEO | 2009/01/01

SECONDARY ACCESSION(S): PRJNA111213

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

siRNA profiling of human colon cancer HT29 cells, siHX transfected vs. control

Project description:HT29 cells were transsfected with siRNA (siHX), which is targeting the human endogeous retrovirus HERV-HX. Cells were harvested 72 h after transfection and knock-down of HERV-HX was evaluated by quantitative RT-PCR. Experiment Overall Design: Two-condition experiment, siHX vs. control cells. 1 transfected, 1 control.

2009-01-14 | E-GEOD-14257 | biostudies-arrayexpress

Transcriptome expression changes after knockdown of ALDH1A1 in human colon cancer cells HT29

Project description:Firstly, shRNA (GCCAAATCATTCCTTGGAATT) was used to knock down ALDH1A1 in HT29 cells, and the knockdown effect was verified by western blot. Then the shALDH1A1 HT29 cells were compared with parental HT29 cells by RNA-seq.

2024-08-27 | GSE225822 | GEO

miRNA profiling of EV71 infected HT29 cells

Project description:HT29 cells was infected with EV71 at MOI 1 or nil respectively and harvested at 36hpi We use miRNA microarray to profile and identify miRNA which are up or down regulated due to EV71 infection

2014-05-08 | GSE57372 | GEO

Transcriptome analysis of novel CPT-CEF-treated HT29 colon cancer cells to evaluate drug cytotoxicity

Project description:Purpose: To identify differentially expressed genes in HT29 colon cancer cells after treatment with a novel formulation of camptothecin with β-cyclodextrin-EDTA-Fe3O4 nanoparticle-conjugated nanocarriers (CPT-CEF) Methods:Treated HT29 cell lines with CPT-CEF, isolated total RNA from HT29 colon cancer cells, and prepared library for RNA sequencing. Carried out comparative transcriptomic studies between treated and untreated cells to find out which gene functions were dysregulated by CPT-CEF. Results: The study yielded 247 DEGs ((FDR<0.05, FC>2.0) that were affected by CPT-CEF treatment in the HT29 colon cancer cells. The results obtained from cell cycle analysis, mitochondrial depolarization assay and acridium orange/propidium iodide double staining showed potential of CPT-CEF in cancer cell inhibition. Conclusion: Our study successfully identified DEGs in the CPT-CEF treated HT29 colon cancer cells that pointed to inhibition of cancer progression. To further affirm, animal studies are needed.

2021-09-15 | GSE165875 | GEO

Diverse effect of WWOX overexpression in HT29 colon cancer cell line.

Project description:The WWOX gene is a tumor suppressor probably involved in regulation of cell cycle and apoptosis and downregulated in variety of cancer types.However, its role in colon cancerogenesis is unknown. The aim of this study was to characterize how WWOX may be involved in colon cancerogenesis or cancer progression, how it influences the basic cancer cell features and modifies cell expression profile.Our observations suggest that in HT29 colon cancer cell line increased expression of WWOX may result in transition of cancer cells into more normal- like colon epithelium phenotype, on the other hand in SW480 WWOX revealed the well-known tumour suppressor properties. However, as the colon cancer is very heterogeneous disease, obtained discrepancies may reflect the known differences between cell lines and cancerogenesis pathway, which they undergone. HT29 colon cancer cells were stably transfected with WWOX cDNA. HT29 cells transfected with an empty vector served as a control. Total mRNA was isolated to look for gene-expression differences induced by the WWOX overexpression.

2014-01-23 | E-GEOD-54298 | biostudies-arrayexpress

ERbeta modulation of NFkB pathway in colon cancer cell lines SW480 and HT29

2020-08-13 | GSE65979 | GEO

ERbeta modulation of NFkB pathway in colon cancer cell lines SW480 and HT29

Project description:Analysis of differentially expressed genes in colon cancer cell lines SW480 and HT29 with and without stably expressed ERbeta gene, with and without 10ng/mL TNFa treatment for 2 and 24 hours. Total RNA obtained from colon cancer cell lines SW480 and HT29 with and without stably expressed ERbeta gene, with and without 10ng/mL TNFa treatment for 2 and 24 hours.

2016-07-17 | E-GEOD-65979 | biostudies-arrayexpress

Expression data from NS398-treated and control HT29 colon adenocarcinoma cell line samples

Project description:The whole-genome oligonucleotide microarray analysis of NS398-treated HT29 colon adenocarcinoma cells samples can give an insight into global molecular background of selective COX2 inhibitor administration in order to find other target molecules and pathways influenced by NS398 selective COX2 inhibitor treatment in the epithelial cells. Total RNA was extracted from NS398-treated and control HT29 colon adenocarcinoma cells and hybridized on Affymetrix HGU133 Plus 2.0 microarrays

2010-03-16 | E-GEOD-15799 | biostudies-arrayexpress

Expression data from shROR HT29 and AGS cell

Project description:Genome-wide cDNA array from HT29,HT29-shROR,HT29-Mock, AGS, AGS-shROR, AGS-Mock cells We used microarrays to detail the global programme of gene expression and identified significantly changed genes after ROR depletion.

2015-06-05 | GSE67416 | GEO

miRNA profiling of EV71 infected HT29 cells

2014-05-08 | E-GEOD-57372 | biostudies-arrayexpress