Cell type-specific cis-regulatory divergence in gene expression and chromatin accessibility revealed by human-chimpanzee hybrid cells
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens Pan troglodytes
PROVIDER: GSE232949 | GEO | 2023/05/23
REPOSITORIES: GEO
Similar Datasets
Project description:Although gene expression divergence has long been postulated to be the primary driver of human evolution, identifying the genes and genetic variants underlying uniquely human traits has proven to be quite challenging. Theory suggests that cell-type-specific cis-regulatory variants may fuel evolutionary adaptation due to the specificity of their effects. These variants can precisely tune the expression of a single gene in a single cell-type, avoiding the potentially deleterious consequences of trans-acting changes and non-cell type-specific changes that can impact many genes and cell types, respectively. It has recently become possible to quantify human-specific cis-acting regulatory divergence by measuring allele-specific expression in human-chimpanzee hybrid cells-the product of fusing induced pluripotent stem (iPS) cells of each species in vitro. However, these cis-regulatory changes have only been explored in a limited number of cell types. Here, we quantify human-chimpanzee cis-regulatory divergence in gene expression and chromatin accessibility across six cell types, enabling the identification of highly cell-type-specific cis-regulatory changes. We find that cell-type-specific genes and regulatory elements evolve faster than those shared across cell types, suggesting an important role for genes with cell-type-specific expression in human evolution. Furthermore, we identify several instances of lineage-specific natural selection that may have played key roles in specific cell types, such as coordinated changes in the cis-regulation of dozens of genes involved in neuronal firing in motor neurons. Finally, using novel metrics and a machine learning model, we identify genetic variants that likely alter chromatin accessibility and transcription factor binding, leading to neuron-specific changes in the expression of the neurodevelopmentally important genes FABP7 and GAD1. Overall, our results demonstrate that integrative analysis of cis-regulatory divergence in chromatin accessibility and gene expression across cell types is a promising approach to identify the specific genes and genetic variants that make us human.
| S-EPMC10942608 | biostudies-literature
Project description:Although gene expression divergence has long been postulated to be the primary driver of human evolution, identifying the genes and genetic variants underlying uniquely human traits has proven to be quite challenging. Theory suggests that cell type-specific cis-regulatory variants may fuel evolutionary adaptation due to the specificity of their effects. These variants can precisely tune the expression of a single gene in a single cell type, avoiding the potentially deleterious consequences of trans-acting changes and non-cell type-specific changes that can impact many genes and cell types, respectively. It has recently become possible to quantify human-specific cis-acting regulatory divergence by measuring allele-specific expression in human-chimpanzee hybrid cells—the product of fusing induced pluripotent stem (iPS) cells of each species in vitro. However, these cis-regulatory changes have only been explored in a limited number of tissues and cell types. Here, we quantify human-chimpanzee cis-regulatory divergence in gene expression and chromatin accessibility across six cell types, enabling the identification of highly cell type-specific cis-regulatory changes. We find that cell type-specific genes and regulatory elements evolve faster than those shared across cell types. Furthermore, we identify several instances of lineage-specific natural selection that may have played key roles in specific cell types, such as coordinated changes in the cis-regulation of dozens of genes involved in neuronal firing in motor neurons. Finally, using novel metrics and a machine learning model, we identify genetic variants that likely alter chromatin accessibility and transcription factor binding, leading to neuron-specific changes in the expression of the neurodevelopmentally important genes FABP7 and GAD1. Overall, our results demonstrate that integrative analysis of cis-regulatory divergence in chromatin accessibility and gene expression across cell types is a promising approach to identify the specific genes and genetic variants that make us human.
2023-05-23 | GSE232947 | GEO
Project description:Although gene expression divergence has long been postulated to be the primary driver of human evolution, identifying the genes and genetic variants underlying uniquely human traits has proven to be quite challenging. Theory suggests that cell type-specific cis-regulatory variants may fuel evolutionary adaptation due to the specificity of their effects. These variants can precisely tune the expression of a single gene in a single cell type, avoiding the potentially deleterious consequences of trans-acting changes and non-cell type-specific changes that can impact many genes and cell types, respectively. It has recently become possible to quantify human-specific cis-acting regulatory divergence by measuring allele-specific expression in human-chimpanzee hybrid cells—the product of fusing induced pluripotent stem (iPS) cells of each species in vitro. However, these cis-regulatory changes have only been explored in a limited number of tissues and cell types. Here, we quantify human-chimpanzee cis-regulatory divergence in gene expression and chromatin accessibility across six cell types, enabling the identification of highly cell type-specific cis-regulatory changes. We find that cell type-specific genes and regulatory elements evolve faster than those shared across cell types. Furthermore, we identify several instances of lineage-specific natural selection that may have played key roles in specific cell types, such as coordinated changes in the cis-regulation of dozens of genes involved in neuronal firing in motor neurons. Finally, using novel metrics and a machine learning model, we identify genetic variants that likely alter chromatin accessibility and transcription factor binding, leading to neuron-specific changes in the expression of the neurodevelopmentally important genes FABP7 and GAD1. Overall, our results demonstrate that integrative analysis of cis-regulatory divergence in chromatin accessibility and gene expression across cell types is a promising approach to identify the specific genes and genetic variants that make us human.
2023-05-23 | GSE232948 | GEO
Project description:Cell type-specific cis-regulatory divergence in gene expression and chromatin accessibility revealed by human-chimpanzee hybrid cells
| PRJNA974465 | ENA
Project description:Cell type-specific cis-regulatory divergence in gene expression and chromatin accessibility revealed by human-chimpanzee hybrid cells [ATAC-seq]
| PRJNA974467 | ENA
Project description:Cell type-specific cis-regulatory divergence in gene expression and chromatin accessibility revealed by human-chimpanzee hybrid cells [RNA-seq]
| PRJNA974466 | ENA
Project description:Gene regulatory divergence is thought to play a central role in determining human-specific traits. However, our ability to link divergent regulation to divergent phenotypes is limited. Here, we utilized human-chimpanzee hybrid induced pluripotent stem cells to study gene expression separating these species. The tetraploid hybrid cells allowed us to separate cis- from trans-regulatory effects, and to control for nongenetic confounding factors. We differentiated these cells into cranial neural crest cells, the primary cell type giving rise to the face. We discovered evidence of lineage-specific selection on the hedgehog signaling pathway, including a human-specific sixfold down-regulation of EVC2 (LIMBIN), a key hedgehog gene. Inducing a similar down-regulation of EVC2 substantially reduced hedgehog signaling output. Mice and humans lacking functional EVC2 show striking phenotypic parallels to human-chimpanzee craniofacial differences, suggesting that the regulatory divergence of hedgehog signaling may have contributed to the unique craniofacial morphology of humans.
| S-EPMC8038968 | biostudies-literature
Project description:Transcription factor (TF) binding is determined by sequence as well as chromatin accessibility. Although the role of accessibility in shaping TF-binding landscapes is well recorded, its role in evolutionary divergence of TF binding, which in turn can alter cis-regulatory activities, is not well understood. In this work, we studied the evolution of genome-wide binding landscapes of five major TFs in the core network of mesoderm specification, between Drosophila melanogaster and Drosophila virilis, and examined its relationship to accessibility and sequence-level changes. We generated chromatin accessibility data from three important stages of embryogenesis in both Drosophila melanogaster and Drosophila virilis and recorded conservation and divergence patterns. We then used multivariable models to correlate accessibility and sequence changes to TF-binding divergence. We found that accessibility changes can in some cases, for example, for the master regulator Twist and for earlier developmental stages, more accurately predict binding change than is possible using TF-binding motif changes between orthologous enhancers. Accessibility changes also explain a significant portion of the codivergence of TF pairs. We noted that accessibility and motif changes offer complementary views of the evolution of TF binding and developed a combined model that captures the evolutionary data much more accurately than either view alone. Finally, we trained machine learning models to predict enhancer activity from TF binding and used these functional models to argue that motif and accessibility-based predictors of TF-binding change can substitute for experimentally measured binding change, for the purpose of predicting evolutionary changes in enhancer activity.
| S-EPMC6601868 | biostudies-literature
Project description:Gene regulatory divergence is thought to play a central role in determining human-specific traits. However, our ability to link divergent regulation to divergent phenotypes is limited. Here, we utilized human-chimpanzee hybrid induced pluripotent stem cells to study divergent gene expression separating these species. The hybrid cells allowed us to separate cis- from trans-regulatory effects, and to control for non-genetic factors that often confound comparative studies. We differentiated these cells into cranial neural crest cells (CNCCs), the primary cell type giving rise to the face, and used the hybrid cells to generate a catalogue of divergent cis-regulatory gene expression between humans and chimpanzees. We found that cis-regulatory divergence is tightly linked to phenotypic divergence, enabling the identification of candidate genes associated with several divergent traits. Specifically, we find support for lineage-specific selection acting on the cis-regulation of the hedgehog signaling pathway. This pathway includes EVC2 (LIMBIN), whose cis-regulation is among the most divergent in the genome, resulting in 6-fold down-regulation along the human lineage. We found that inducing a similar reduction in EVC2 levels substantially reduces Hh signaling output. Mice and humans lacking functional EVC2 show striking parallels to many human-chimpanzee phenotypic differences, particularly in the skull and face, suggesting that the regulatory divergence of Hh signaling may have contributed to the unique craniofacial morphology of humans. In sum, our results suggest that human-chimpanzee hybrid cells can serve as a valuable resource to study the evolution of gene regulation and its impact on phenotypic divergence. SRA/fastq files include Illumina adapters (GATCGGAAGAGCACACGTCT and GATCGGAAGAGCGTCGTGTA).
2020-10-09 | GSE146481 | GEO
Project description:Linking regulatory DNA elements to their target genes, which may be located hundreds of kilobases away, remains challenging. Here, we introduce Cicero, an algorithm that identifies co-accessible pairs of DNA elements using single-cell chromatin accessibility data and so connects regulatory elements to their putative target genes. We apply Cicero to investigate how dynamically accessible elements orchestrate gene regulation in differentiating myoblasts. Groups of Cicero-linked regulatory elements meet criteria of "chromatin hubs"-they are enriched for physical proximity, interact with a common set of transcription factors, and undergo coordinated changes in histone marks that are predictive of changes in gene expression. Pseudotemporal analysis revealed that most DNA elements remain in chromatin hubs throughout differentiation. A subset of elements bound by MYOD1 in myoblasts exhibit early opening in a PBX1- and MEIS1-dependent manner. Our strategy can be applied to dissect the architecture, sequence determinants, and mechanisms of cis-regulation on a genome-wide scale.
| S-EPMC6582963 | biostudies-literature