Browse
Submit Data
Databases
API
Help

Dataset Information

35 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Human-chimpanzee fused cells reveal cis-regulatory divergence underlying skeletal evolution.

ABSTRACT: Gene regulatory divergence is thought to play a central role in determining human-specific traits. However, our ability to link divergent regulation to divergent phenotypes is limited. Here, we utilized human-chimpanzee hybrid induced pluripotent stem cells to study gene expression separating these species. The tetraploid hybrid cells allowed us to separate cis- from trans-regulatory effects, and to control for nongenetic confounding factors. We differentiated these cells into cranial neural crest cells, the primary cell type giving rise to the face. We discovered evidence of lineage-specific selection on the hedgehog signaling pathway, including a human-specific sixfold down-regulation of EVC2 (LIMBIN), a key hedgehog gene. Inducing a similar down-regulation of EVC2 substantially reduced hedgehog signaling output. Mice and humans lacking functional EVC2 show striking phenotypic parallels to human-chimpanzee craniofacial differences, suggesting that the regulatory divergence of hedgehog signaling may have contributed to the unique craniofacial morphology of humans.

SUBMITTER: Gokhman D

PROVIDER: S-EPMC8038968 | biostudies-literature |

REPOSITORIES: biostudies-literature

ACCESS DATA

Json Xml

Similar Datasets

Human-chimpanzee hybrid cells reveal gene regulatory evolution underlying skeletal divergence

Project description:Gene regulatory divergence is thought to play a central role in determining human-specific traits. However, our ability to link divergent regulation to divergent phenotypes is limited. Here, we utilized human-chimpanzee hybrid induced pluripotent stem cells to study divergent gene expression separating these species. The hybrid cells allowed us to separate cis- from trans-regulatory effects, and to control for non-genetic factors that often confound comparative studies. We differentiated these cells into cranial neural crest cells (CNCCs), the primary cell type giving rise to the face, and used the hybrid cells to generate a catalogue of divergent cis-regulatory gene expression between humans and chimpanzees. We found that cis-regulatory divergence is tightly linked to phenotypic divergence, enabling the identification of candidate genes associated with several divergent traits. Specifically, we find support for lineage-specific selection acting on the cis-regulation of the hedgehog signaling pathway. This pathway includes EVC2 (LIMBIN), whose cis-regulation is among the most divergent in the genome, resulting in 6-fold down-regulation along the human lineage. We found that inducing a similar reduction in EVC2 levels substantially reduces Hh signaling output. Mice and humans lacking functional EVC2 show striking parallels to many human-chimpanzee phenotypic differences, particularly in the skull and face, suggesting that the regulatory divergence of Hh signaling may have contributed to the unique craniofacial morphology of humans. In sum, our results suggest that human-chimpanzee hybrid cells can serve as a valuable resource to study the evolution of gene regulation and its impact on phenotypic divergence. SRA/fastq files include Illumina adapters (GATCGGAAGAGCACACGTCT and GATCGGAAGAGCGTCGTGTA).

2020-10-09 | GSE146481 | GEO

Human-chimpanzee hybrid cells reveal gene regulatory evolution underlying skeletal divergence

Project description:Human-chimpanzee hybrid cells reveal gene regulatory evolution underlying skeletal divergence

| PRJNA610639 | ENA

Enhancer divergence and cis-regulatory evolution in the human and chimpanzee neural crest

Project description:Here we derive human and chimpanzee cranial neural crest cells (CNCCs) and profile histone modifications, transcription factors, chromatin accessibility and gene expression to systematically and quantitatively annotate evolutionary divergence of craniofacial cis-regulatory landscapes. Histone modifications (H3K27ac, H3K4me1, H3K4me3, H3K27me3), chromatin modifiers (p300), transcription factors (NR2F1, TFAP2A), chromatin accessibility (ATACseq) and gene expression (RNAseq) were assayed in CNCCs derived from iPSCs/ESCs from 2 chimpanzee and 3 human individuals.

2015-09-11 | E-GEOD-70751 | biostudies-arrayexpress

Enhancer divergence and cis-regulatory evolution in the human and chimpanzee neural crest

2015-09-11 | GSE70751 | GEO

Evolution of candidate transcriptional regulatory motifs since the human-chimpanzee divergence.

Project description:Despite the recent completion of the chimpanzee genome project, few functionally significant sequence differences between humans and chimpanzees have thus far been identified. Alteration in transcriptional regulatory mechanisms represents an important platform for evolutionary change, suggesting that a significant proportion of functional human-chimpanzee sequence differences may affect regulatory elements.To explore this hypothesis, we performed genome-wide identification of conserved candidate transcription-factor binding sites that have evolved since the divergence of humans and chimpanzees. Analysis of candidate transcription-factor binding sites conserved between mouse and chimpanzee yet absent in human indicated that loss of candidate transcription-factor binding sites in the human lineage was not random but instead correlated with the biologic functions of associated genes.Our data support the notion that changes in transcriptional regulation have contributed to the recent evolution of humans. Moreover, genes associated with mutated candidate transcription-factor binding sites highlight potential pathways underlying human-chimpanzee divergence.

| S-EPMC1779530 | biostudies-literature

Few Fixed Variants between Trophic Specialist Pupfish Species Reveal Candidate Cis-Regulatory Alleles Underlying Rapid Craniofacial Divergence.

Project description:Investigating closely related species that rapidly evolved divergent feeding morphology is a powerful approach to identify genetic variation underlying variation in complex traits. This can also lead to the discovery of novel candidate genes influencing natural and clinical variation in human craniofacial phenotypes. We combined whole-genome resequencing of 258 individuals with 50 transcriptomes to identify candidate cis-acting genetic variation underlying rapidly evolving craniofacial phenotypes within an adaptive radiation of Cyprinodon pupfishes. This radiation consists of a dietary generalist species and two derived trophic niche specialists-a molluscivore and a scale-eating species. Despite extensive morphological divergence, these species only diverged 10 kya and produce fertile hybrids in the laboratory. Out of 9.3 million genome-wide SNPs and 80,012 structural variants, we found very few alleles fixed between species-only 157 SNPs and 87 deletions. Comparing gene expression across 38 purebred F1 offspring sampled at three early developmental stages, we identified 17 fixed variants within 10 kb of 12 genes that were highly differentially expressed between species. By measuring allele-specific expression in F1 hybrids from multiple crosses, we found that the majority of expression divergence between species was explained by trans-regulatory mechanisms. We also found strong evidence for two cis-regulatory alleles affecting expression divergence of two genes with putative effects on skeletal development (dync2li1 and pycr3). These results suggest that SNPs and structural variants contribute to the evolution of novel traits and highlight the utility of the San Salvador Island pupfish system as an evolutionary model for craniofacial development.

| S-EPMC7826174 | biostudies-literature

Enhancer divergence and cis-regulatory evolution in the human and chimp neural crest.

Project description:cis-regulatory changes play a central role in morphological divergence, yet the regulatory principles underlying emergence of human traits remain poorly understood. Here, we use epigenomic profiling from human and chimpanzee cranial neural crest cells to systematically and quantitatively annotate divergence of craniofacial cis-regulatory landscapes. Epigenomic divergence is often attributable to genetic variation within TF motifs at orthologous enhancers, with a novel motif being most predictive of activity biases. We explore properties of this cis-regulatory change, revealing the role of particular retroelements, uncovering broad clusters of species-biased enhancers near genes associated with human facial variation, and demonstrating that cis-regulatory divergence is linked to quantitative expression differences of crucial neural crest regulators. Our work provides a wealth of candidates for future evolutionary studies and demonstrates the value of "cellular anthropology," a strategy of using in-vitro-derived embryonic cell types to elucidate both fundamental and evolving mechanisms underlying morphological variation in higher primates.

| S-EPMC4848043 | biostudies-literature

Chimpanzee super strength and human skeletal muscle evolution.

Project description:Since at least the 1920s, it has been reported that common chimpanzees (Pan troglodytes) differ from humans in being capable of exceptional feats of "super strength," both in the wild and in captive environments. A mix of anecdotal and more controlled studies provides some support for this view; however, a critical review of available data suggests that chimpanzee mass-specific muscular performance is a more modest 1.5 times greater than humans on average. Hypotheses for the muscular basis of this performance differential have included greater isometric force-generating capabilities, faster maximum shortening velocities, and/or a difference in myosin heavy chain (MHC) isoform content in chimpanzee relative to human skeletal muscle. Here, we show that chimpanzee muscle is similar to human muscle in its single-fiber contractile properties, but exhibits a much higher fraction of MHC II isoforms. Unlike humans, chimpanzee muscle is composed of ?67% fast-twitch fibers (MHC IIa+IId). Computer simulations of species-specific whole-muscle models indicate that maximum dynamic force and power output is 1.35 times higher in a chimpanzee muscle than a human muscle of similar size. Thus, the superior mass-specific muscular performance of chimpanzees does not stem from differences in isometric force-generating capabilities or maximum shortening velocities-as has long been suggested-but rather is due in part to differences in MHC isoform content and fiber length. We propose that the hominin lineage experienced a decline in maximum dynamic force and power output during the past 7-8 million years in response to selection for repetitive, low-cost contractile behavior.

| S-EPMC5514706 | biostudies-literature

Mouse regulatory DNA landscapes reveal global principles of cis-regulatory evolution.

Project description:To study the evolutionary dynamics of regulatory DNA, we mapped >1.3 million deoxyribonuclease I-hypersensitive sites (DHSs) in 45 mouse cell and tissue types, and systematically compared these with human DHS maps from orthologous compartments. We found that the mouse and human genomes have undergone extensive cis-regulatory rewiring that combines branch-specific evolutionary innovation and loss with widespread repurposing of conserved DHSs to alternative cell fates, and that this process is mediated by turnover of transcription factor (TF) recognition elements. Despite pervasive evolutionary remodeling of the location and content of individual cis-regulatory regions, within orthologous mouse and human cell types the global fraction of regulatory DNA bases encoding recognition sites for each TF has been strictly conserved. Our findings provide new insights into the evolutionary forces shaping mammalian regulatory DNA landscapes.

| S-EPMC4337786 | biostudies-other

Divergent whole-genome methylation maps of human and chimpanzee brains reveal epigenetic basis of human regulatory evolution.

Project description:DNA methylation is a pervasive epigenetic DNA modification that strongly affects chromatin regulation and gene expression. To date, it remains largely unknown how patterns of DNA methylation differ between closely related species and whether such differences contribute to species-specific phenotypes. To investigate these questions, we generated nucleotide-resolution whole-genome methylation maps of the prefrontal cortex of multiple humans and chimpanzees. Levels and patterns of DNA methylation vary across individuals within species according to the age and the sex of the individuals. We also found extensive species-level divergence in patterns of DNA methylation and that hundreds of genes exhibit significantly lower levels of promoter methylation in the human brain than in the chimpanzee brain. Furthermore, we investigated the functional consequences of methylation differences in humans and chimpanzees by integrating data on gene expression generated with next-generation sequencing methods, and we found a strong relationship between differential methylation and gene expression. Finally, we found that differentially methylated genes are strikingly enriched with loci associated with neurological disorders, psychological disorders, and cancers. Our results demonstrate that differential DNA methylation might be an important molecular mechanism driving gene-expression divergence between human and chimpanzee brains and might potentially contribute to the evolution of disease vulnerabilities. Thus, comparative studies of humans and chimpanzees stand to identify key epigenomic modifications underlying the evolution of human-specific traits.

| S-EPMC3511995 | biostudies-literature

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data