Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

The effect of KIF11 knockdown on gene expression profile in HepG2 cells

ABSTRACT: High-throughput sequencing is performed to identify the genes whose expression levels were altered when KIF11 is downregulated by lentiviruses-mediated shRNA in HepG2 cells.

ORGANISM(S): Homo sapiens

PROVIDER: GSE238164 | GEO | 2023/07/30

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

The effect of KIF11 knockdown on gene expression profile in HepG2 cells

Project description:The effect of KIF11 knockdown on gene expression profile in HepG2 cells

| PRJNA998071 | ENA

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes. LNCaP cells logarthmically growing in full serum was infected with three different shRNA lentiviruses. Three days after infection

2013-05-10 | E-GEOD-46329 | biostudies-arrayexpress

HepG2 TP53BP2-knockdown

Project description:HepG2 TP53BP2-knockdown

| PRJNA854656 | ENA

Study the effect of calreticulin knockdown on genome-wide transcript expression in HepG2 cells

Project description:The objective was to evaluate the status of the global hepatic transcriptome in the presence of inhibited calreticulin levels. Results identify a total of 324 genes were altered of which 245 genes were downregulated and 79 genes were upregulated. This suggests that such altered genes might be associated with altered hepatic physiology that are observed during calreticulin deficiency. Total RNA was isolated from HepG2 cells subjected to calreticulin (CRT) siRNA for 24 hours compared to control HepG2 cells subjected to scramble siRNA for 24 hours. This was then hybridized to Illumina HumanHT-12 v4 Expression BeadChip arrays.

2015-07-23 | E-GEOD-57261 | biostudies-arrayexpress

siRNA profiling of human HepG2 cells with jam-A Knockdown

Project description:Hepatocytes are polarized epithelial cells whose function depends upon their ability to distinguish between the apical and basolateral surfaces that are located at intercellular tight junctions. It has been proposed that the signaling cascades that originate at these junctions influence cellular activity by controlling gene expression in the cell nucleus. To assess the validity of this proposal with regard to hepatocytes, we depleted expression of the tight junction protein junctional adhesion molecule-A (JAM-A) in the HepG2 human hepatocellular carcinoma cell line. Reduction of JAM-A resulted in a striking change in cell morphology, with cells forming single-layered sheets instead of the normal multi-layered clusters. In the absence of JAM-A, other tight junction proteins were mislocalized, and canaliculi, which form the apical face of the hepatocyte, were consequently absent. While most changes in gene expression were modest, there was a strong transcriptional induction of the adherens junction protein E-cadherin in cells with reduced levels of JAM-A. This increase in E-cadherin was partially responsible for the observed alterations in cell morphology and mislocalization of tight junction proteins. We therefore propose that we have uncovered a novel mechanism for crosstalk between specific components of tight and adherens junctions that can be utilized to regulate adhesion between hepatic cells and to maintain hepatocyte cell polarity. Experiment Overall Design: HepG2 cells were transduced with lentiviruses and stably selected using puromycin. Comparison of four controls and five JAM-A knockdown samples.

2008-06-14 | E-GEOD-6080 | biostudies-arrayexpress

Depletion of PARP-2 in HepG2 cells

Project description:Poly(ADP-ribose) polymerase-2 (PARP-2) is acknowledged as a DNA repair enzyme; however, recently metabolic properties had been attributed to it. Hereby, we examined the metabolic consequences of PARP-2 ablation in liver. Microarray analysis of PARP-2 knockdown HepG2 cells revealed the dysregulation of lipid and cholesterol metabolism genes. Induction of cholesterol biosynthesis genes stemmed from the enhanced expression of sterol-regulatory element binding protein (SREBP)-1. We revealed that PARP-2 is a suppressor of the SREBP-1 promoter, therefore ablation of PARP-2 induces SREBP-1 expression and consequently cholesterol synthesis. PARP-2-/- mice had higher SREBP-1 expression that was translated into enhanced hepatic and serum cholesterol levels. PARP-2 silencing was performed employing shPARP-2 (small hairpin) and scPARP-2 (scrambled) shRNA by lentiviral delivery (Sigma) using 40 MOI lentiviruses coding shRNA sequence against PARP-2.

2013-12-31 | E-GEOD-43981 | biostudies-arrayexpress

The impact of lncRNA LAST knockdown on gene expression profile in HCT116 cells

Project description:High-throughput sequencing was employed to analyze the genes whose expression are altered when lncRNA LAST is downregulated by shRNA in HCT116 cells. The Gencode Gene ID of lncRNA LAST is ENSG00000254682.1.

2017-11-16 | GSE106917 | GEO

Effect of ZFP740 knockdown on HepG2 cells

Project description:Effect of ZFP740 knockdown on HepG2 cells

| PRJNA1117433 | ENA

HepG2 HepAD38 TP53BP2-knockdown

Project description:HepG2 HepAD38 TP53BP2-knockdown

| PRJNA854649 | ENA

Effect of ZFP740 knockdown on HepG2 cells

Project description:To investigate the effect of ZFP740 gene expression on hepatocellular carcinoma cells, we used the hepatocellular carcinoma cell line HepG2, and then divided into two groups, in which the control group was HepG2, and the intervention group was HepG2 with the knockdown of the ZNF740 gene, and three samples were sent to each group for RNA seq sequencing

2024-07-04 | GSE268479 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data