Dataset Information

Integrated HPV18 acts as enhancer-like RNA and form phase-separated condensates to promote oncogenic genes expression.

ABSTRACT: Most of the cervical cancers are caused by human papillomavirus (HPV) infection. It has been known that, in HeLa cells, HPV18 viral genome is integrated at chromosome 8q24.21 and activates transcription of proto-oncogene c-Myc. However, the mechanism of how the integrated HPV fragment exhibits transcription activation function has not been fully elucidated. In this study, we found that HPV18 transcripts themselves have an enhancer RNA-like function to activate their proximal genes including CCAT1-5L and c-Myc. We showed that the human genome-integrated HPV18 genes are activated by transcription coregulators BRD4, Mediator. The transcribed HPV18 RNAs form a liquid-like condensate at chromosome 8q24.21 locus, which in turn accumulates RNA polymerase II. Moreover, we identified uncharacterized transcript from Upstream Region of CCAT1-5L, named URC. The URC RNA is transcribed as a chimera RNA with HPV18 and is composed of 3'-untranslated region of HPV18 transcript. We found that the URC contributes to stabilization of HPV18 RNAs by supplying a poly-adenylation site for HPV18 transcript. Our findings suggest that HPV18 integration at 8q24.21 locus causes HPV18-URC chimera RNA and promotes tumorigenesis through RNA-based liquid droplet formation.

ORGANISM(S): Homo sapiens

PROVIDER: GSE249929 | GEO | 2024/12/31

REPOSITORIES: GEO

ACCESS DATA

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Project description:CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells. The 3C-Seq design and data analysis were performed according to Stadhouders et al, Nat Protoc. 2013, 8:509-524. A series of bait sequences accommodating different locus around CCAT1-L and MYC were selected. Through integrating with specific sample barcodes, bait-specific primer sets were designed to construct relevant 3C-seq libraries in CCAT1-L knockdown and scramble knockdown (Scr) HT29 samples. All of the 3C sample libraries from different treatment, including CCAT1-L knockdown and scramble knockdown (Scr), were then pooled together for high-throughput sequencing. Two technical 3C-seq were performed (CCAT1_myc_3C_1.txt.gz and CCAT1_myc_3C_2.txt.gz) and then combined together to get enough reads for further analysis. 3C-seq reads from different samples were divided according to sample barcodes (CCAT1-L knockdown: ATGTCA; Scr: GCCAAT) and different bait sequences, and then mapped to human reference genome to assess chromatin interaction strength between CCAT1-L and MYC locus in different treatments. In our study, one representative bait-specific sequencing data (CTTCTACTGATTGGCCCTAAACACTTTTCCAAAGCTT) was select to generate bedgraph files and upload to UCSC for visualization to show the chromatin interaction between CCAT1-L and Myc locus in CCAT1-L knockdown (CCAT1-L_knockdown_out.bedgraph) and scramble knockdown (Scr_out.bedgraph) samples.

Dataset Information

Integrated HPV18 acts as enhancer-like RNA and form phase-separated condensates to promote oncogenic genes expression.

Dataset's files

Similar Datasets

OmicsDI is part of the ELIXIR infrastructure

Tweets