Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

New perspective on the origin of adaptive evolution: a study on cytidine deaminase in lampreys

ABSTRACT: This study evaluates the similarity of adaptive immune mechanisms between jawless and jawed vertebrates using lamprey cytidine deaminase (CDA). We identified the ancestral gene Lr-CDAs of the AID/APOBEC deaminase family and evaluated its biological function in vivo. Lr-CDA1 deletion affected the assembly of three types of variable lymphocyte receptors (VLRs). We identified a switch-like region in lamprey gVLRs bound to Lr-CDAs, which upon repression, downregulated VLRB expression. Overall, we propose that lampreys have an early form of class switch recombination (CSR) that is mediated by Lr-CDAs and acts on gVLRs, affecting the assembly, maturation, and diversity regulation of VLR genes in Lethenteron reissneri. This CSR process in lampreys is linked to tumorigenesis and chromosomal translocation markers via Lr-CDAs.

ORGANISM(S): Lethenteron reissneri

PROVIDER: GSE252201 | GEO | 2024/04/16

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Activation-induced cytidine deaminase induces reproducible DNA breaks at many non-Ig loci in activated B cells

Project description:After immunization or infection, activation-induced cytidine deaminase (AID) initiates diversification of immunoglobulin (Ig) genes in B cells, introducing mutations within the antigen binding V regions (somatic hypermutation, SHM) and double-strand DNA breaks (DSBs) into switch (S) regions, leading to antibody class switch recombination (CSR). Using a candidate approach, AID has been shown to initiate mutations at numerous non-Ig genes in B cells in Peyer’s patches. However, it is not known if during B cell activation, AID also induces DNA breaks at genes other than IgH genes, which would lead to genomic instability and malignancy. Using a non-biased genome-wide approach, we have identified hundreds of reproducible AID-dependent DSBs in mouse splenic B cells shortly after induction of CSR in culture. Most interestingly, AID induces DSBs at sites syntenic with sites of translocations, deletions, and amplifications found in human B cell lymphomas, including within the oncogene B cell lymphoma11a (bcl11a)/evi9. The AID-dependent DSBs are not restricted to transcribed regions, and they frequently occur within repeated sequence elements, including CA and non-CA repeats, and SINEs. Comparison of Nbs1 binding sites in wild-type vs. aid-/- splenic B cells induced to undergo CSR; aid-dependent Nbs1 sites correlated with gene transcription (RNA Pol2).

2011-01-21 | E-GEOD-24827 | biostudies-arrayexpress

New perspective on the origin of adaptive evolution: a study on cytidine deaminase in lampreys

Project description:New perspective on the origin of adaptive evolution: a study on cytidine deaminase in lampreys

| PRJNA1058534 | ENA

Genome wide localization of Activation induced cytidine deaminase (AID), Spt5, and RNA Polymerase II (PolII) in mouse

Project description:Activation induced cytidine deaminase (AID) initiates antibody gene diversification by creating U:G mismatches. However, AID is not specific for antibody genes. Off-target lesions can activate oncogenes or cause chromosome translocations. Despite its importance in these key transactions little is known about how AID finds its target sites. To examine AID regulation we performed an shRNA screen. We found that Spt5, a factor associated with paused RNA polymerase II (Pol II) and single stranded DNA (ssDNA), is required for class switch recombination (CSR). Spt5 interacts with AID, it is required for the association of AID and Pol II, and for AID recruitment to switch regions. ChIP-seq experiments reveal that Spt5 co-localizes with AID and stalled Pol II. Further, Spt5 accumulation at sites of Pol II pausing is predictive of AID-induced mutation. Our data suggest that Spt5 acts as an adaptor, which brings AID to Pol II on target DNA. PolII, AID, and Spt5 were immunoprecipitated from in vitro activated B cells. For Spt5 and AID, two different antibodies were used in separate, biological replicates

2010-10-05 | E-GEOD-24178 | biostudies-arrayexpress

Molecular characterizations of cell types in the adult sea lamprey retina

Project description:As an ancient jawless vertebrate species, the lamprey offers an important model to probe the evolutionary history of retinal cells. In this study, we generated a cell atlas of the adult sea lamprey retina using single-cell RNA sequencing

2024-03-04 | GSE236005 | GEO

Activation-induced cytidine deaminase induces reproducible DNA breaks at many non-Ig loci in activated B cells

2011-01-21 | GSE24827 | GEO

Genome-wide localization of Smc1, Smc3 and CTCF in mouse B cells.

Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to switch regions and by the subsequent generation and resolution of dsDNA breaks (DSBs). During, CSR the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and switch regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we show that during CSR, AID associates with subunits of cohesin, a complex previously implicated in DNA repair and in the formation of DNA loops between enhancers and promoters. By ChIP-Seq experiments, we find that Cohesin is dynamically recruited to the IgH locus during CSR and that knockdown of Cohesin or its regulatory subunits results in impaired CSR and abnormal DSB resolution. Our results are consistent with a model in which Cohesin controls the formation of long-range DNA loops at the IgH locus and the resolution of DSBs generated during CSR. Smc1, Smc3 and CTCF were immunoprecipitated from resting or in vitro activated B cells.

2013-10-11 | E-GEOD-43594 | biostudies-arrayexpress

Med1 facilitates transcriptional activation and dynamic long-range contacts at the IgH locus during class switch recombination.

Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR. 4C-seq data in resting and activated WT and Med1 mutant B cells. 4C bait was designed in the Eu enhancer of the Igh locus on chromosome 12. Primer sequences: 5â TCTGTCCTAAAGGCTCTGAGA 3â and 5â GAACACAGAAGTATGTGTATGGA 3â.

2016-02-17 | E-GEOD-62969 | biostudies-arrayexpress

Shared features of blastula and neural crest stem cells evolved at the base of vertebrates

Project description:We address the evolutionary origins of vertebrate pluripotency by comparing the development of neural crest and blastula stem cells using representatives from both jawed (Xenopus) and jawless (lamprey) vertebrates.

2024-06-21 | GSE205436 | GEO

Med1 facilitates transcriptional activation and dynamic long-range contacts at the IgH locus during class switch recombination.

Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR.

2016-02-17 | GSE62969 | GEO

Genome wide localization of Activation induced cytidine deaminase (AID), Spt5, and RNA Polymerase II (PolII) in mouse

2010-10-05 | GSE24178 | GEO