Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

CcRNA identification by circularization and miSeq

ABSTRACT: Efforts to identify ccRNA by sequencing by gibson circularization after template-switching 5' RACE using a cRNA-end specific primer and subsequent sequencing by Illumina miSeq. Sequencing of wild-type A/WSN/1933 and a variant bearing the mutation T677A in the PB1 subunit.

ORGANISM(S): Homo sapiens

PROVIDER: GSE276698 | GEO | 2024/09/10

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Similar Datasets

Accessory subunits are integral for assembly and function of human mitochondrial complex I

Project description:For analysis of mRNA expression levels, total RNA was harvested from each cell-line in replicate with Trizol™ (Thermo scientific). Total RNA was purified using Direct-zol™ columns according to the manufacturers specifications (Zymo Research). For cDNA synthesis 1 μg of total RNA was process as the T12VN-PAT assay (Jänicke et al., RNA 2012), except that this was adapted for multiplexing on the Illumina MiSeq instrument. We refer to this assay as mPAT for multiplexed PAT. The approach is based on a nested-PCR that sequentially incorporates the Illumina platform’s flow-cell specific terminal extensions onto 3’ RACE PCR amplicons. First, cDNA was generated using the anchor primer mPAT Reverse, next this primer and a pool of 50 gene-specific primers were used in 5 cycles of amplification. Each gene-specific primer had a universal 5’ extension (see supplementary file primers) for sequential addition of the 5’ (P5) Illumina elements. These amplicons were then purified using NucleoSpin columns (Macherey-Nagel), and entered into second round amplification using the universal Illumina Rd1 sequencing Primer and TruSeq indexed reverse primers from Illumina. Second round amplification was for 14 cycles. Note, that each experimental condition was amplified separately in the first round with identical primers. In the second round, a different indexing primer was used for each experimental condition. All PCR reactions were pooled and run using the MiSeq Reagent Kit v2 with 300 cycles (i.e. 300 bases of sequencing) according to the manufacturers specifications. Data were analysed using established bioinformatics pipelines (Harrison et al., RNA 2015)

2016-09-08 | GSE84913 | GEO

mRNA circularization by METTL3-eIF3h enhances translation

Project description:mRNA circularization by METTL3-eIF3h enhances translation

| PRJNA481680 | ENA

Miseq-test

Project description:miseq-test

| PRJEB5483 | ENA

Increasing miRNA sequencing accuracy using an RNA circularization approach

Project description:Increasing miRNA sequencing accuracy using an RNA circularization approach

| PRJNA419732 | ENA

8-week WT or Ftsj1 KO mouse brain tRNA and tRF MiSeq

Project description:8-week brain total tRNA, total tRNA fragments (tRFs), and ribosome-contained tRNAs were sequenced using MiSeq.

2021-03-31 | GSE153757 | GEO

A single N66S mutation in the PB1-F2 protein of influenza A virus increases virulence by inhibiting the early interferon response in vivo

Project description:This study used virological, histological, and global gene expression from an experimental murine model of influenza infection to study the contribution of a specific mutation in the PB1-F2 protein (PB1-F2 N66S) of influenza A to viral pathogenesis. 6-8 week old, wild-type, female, C57Bl/6 mice were inoculated individually with 30 μl (10^4 PFU) of virus (recombinant influenza A/WSN/33 carrying the PB1 gene segment from A/Hong Kong/156/97 (H5N1) or a PB1 mutant recombinant virus resulting in an amino acid change at position 66 in the PB1-F2 protein [N66S]) in phosphate-buffered saline (PBS) containing penicillin-streptomycin and bovine serum albumin (PBS-BA-PS). A total of 10^4 PFU of virus was given in all inoculations. Control mice were given PBS-BA-PS. Lung samples were taken for microarray analysis at 12h, 1d, 3d, and 5d post-infection (n=3 animals per group at each time point for virus infected animals; n=2 animals per time point for mock-infected animals).

2012-02-20 | E-GEOD-35940 | biostudies-arrayexpress

Widespread and Functional RNA Circularization in Localized Prostate Cancer.

Project description:Widespread and Functional RNA Circularization in Localized Prostate Cancer.

| PRJNA450081 | ENA

NicOPURE: Nickless RNA Circularization and One-Step Purification with Engineered Group II Introns and Cyclizing UTRs

Project description:Circular RNAs (circRNAs) have gained significant attention in recent years due to their diverse biological functions and potential as novel therapeutic modality. Two general mechanisms for generating circRNAs involves the utilization of group 1 and group 2 introns, which are self-splicing ribozymes found in many organisms. Although group 1 intron has been demonstrated to be highly effective in circularization, the reaction requires high temperature plus cofactors such as GTP. Consequently, undesired byproducts such as nicked RNA were generated, which requires complex purification steps before downstream applications. In this study, we have strategically designed structural elements and incorporated sequence features to enhance the efficacy of RNA circularization by group 2 introns. This innovative approach occurred at a reduced temperature and resulted in notably fewer nicks compared to group 1 introns. Furthermore, to streamline the purification process of circular RNA, we incorporated two halves of streptavidin aptamer tags into the enzymatic sites of the group 2 intron. This strategic architecture guarantees the creation of a fully operational streptavidin aptamer tag solely at the circular RNA junction site during in vitro circularization. This unique attribute facilitates a one-step purification process. The resulting "NicOPURE" system emerges as both straightforward and efficient in generating therapeutic circular mRNAs.

2023-10-29 | GSE246246 | GEO

Hhigh-throughput sequencing of in vitro fecal fermentation samples

Project description:We report the use of high-throughput sequencing technology to detect the microbial composition and abundance of mice grastic contents before and after Helicobacter pylori infection or Lactobacillus paracasei ZFM54 pretreatment/treatment. The genomic DNA was obtained by the QIAamp PowerFecal DNA Kit. Then, the DNA samples were sent to BGI Genomics Co., Ltd. (Shenzhen, China) for V3-V4 region of the 16S rRNA gene high-throughput sequencing with an Illumina MiSeq platform. DNA samples were sequenced using primers 338F (forward primer sequence ACTCCTACGGGAGGCAGCAG)-806R (reverse primer sequence GGACTACHVGGGTWTCTAAT). The sequencing analyses were carried out using silva138/16s database as a reference for the assignation of Amplicon Sequence Variant (ASV) at 100% similarity.

2022-07-27 | GSE208665 | GEO

Efficient Circularization of Protein-Encoding RNAs via a Novel Cis-Splicing System

Project description:Circular RNAs (circRNAs) have emerged as a promising alternative to linear mRNA, owing to their unique properties and potential therapeutic applications, driving the development of novel approaches for their production. This study introduces a cis-splicing system that efficiently produces circRNAs by incorporating a ribozyme core at one end of the precursor, thereby eliminating the need for additional spacer elements between the ribozyme and the gene of interest (GOI). In this cis-splicing system, sequences resembling homologous arms at both ends of the precursor are crucial for forming the P9.0 duplex, which in turn facilitates effective self-splicing and circularization. We demonstrate that the precise recognition of the second transesterification site depends more on the structural characteristics of P9.0 adjacent to the ωG position than on the nucleotide composition of the P9.0-ωG itself. Further optimization of structural elements, like P10 and P1-ex, significantly improves circularization efficiency. The circRNAs generated through the cissplicing system exhibit prolonged protein expression and minimal activation of the innate immune response. This study provides a comprehensive exploration of circRNA generation via a novel strategy and offers valuable insights into the structural engineering of RNA, paving the way for future advancements in circRNA-based applications.

2024-08-21 | GSE263525 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data