Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Methylation map of 8 neuroblastoma cell lines: NGS after MBD2-capture

ABSTRACT: 8 neuroblastoma (NB) cell lines (CLB-GA, IMR-32, SH-SY5Y, N206, CHP-902R, LAN-2, SK-N-AS, SJNB-1) their methylome is determined by sequencing after MBD2-capture using MethylCollector (ActiveMotif)

ORGANISM(S): Homo sapiens

PROVIDER: GSE31353 | GEO | 2012/09/13

SECONDARY ACCESSION(S): PRJNA154163

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Methylation map of 8 neuroblastoma cell lines: NGS after MBD2-capture

Project description:8 neuroblastoma (NB) cell lines (CLB-GA, IMR-32, SH-SY5Y, N206, CHP-902R, LAN-2, SK-N-AS, SJNB-1) their methylome is determined by sequencing after MBD2-capture using MethylCollector (ActiveMotif) 8 NB cell lines were included (CLB-GA, IMR-32, SH-SY5Y, N206, CHP-902R, LAN-2, SK-N-AS, SJNB-1) in this study. After shearing (fragments of about 200 bp), DNA was captured using MBD2-capture (MethylCollector - ActiveMotif) followed by library preparation and multiplexing. Captured sequence tags were sequenced paired-end (2 x 45 bp) on Illumina GAIIx.

2012-09-13 | E-GEOD-31353 | biostudies-arrayexpress

Neuroblastoma cell lines treated with DAC (2'-deoxy-5-azacytidine), a DNA-methylation inhibitor

Project description:8 neuroblastoma (NB) cell lines (CLB-GA, IMR-32, SH-SY5Y, N206, CHP-902R, LAN-2, SK-N-AS, SJNB-1) were profiled on the Affymetrix HGU-133plus2,0 platform before and after treatment with DAC (2'-deoxy-5-azacytidine) to investigate the influence on expression after inhibiting DNA-methylation 8 NB cell lines were included (CLB-GA, IMR-32, SH-SY5Y, N206, CHP-902R, LAN-2, SK-N-AS, SJNB-1), before and after treatment with 3 micromolars of DAC for 3 days

2012-09-13 | E-GEOD-31229 | biostudies-arrayexpress

Neuroblastoma cell lines treated with DAC (2'-deoxy-5-azacytidine), a DNA-methylation inhibitor

2012-09-13 | GSE31229 | GEO

ChIP-seq of neuroblastoma IMR-32, CLB-GA, NGP, IMR-5/75, GI-M-EN, CHP-212, and IMR-5 cell lines to identify TBX2, MYCN, H3K27ac, H3K4me1 and H3K4me3 binding sites

Project description:ChIP-seq to define bindings sites for TBX2, MYCN, H3K27ac, H3K4me1, H3K4me3 and Input in the cell lines IMR-32, CLB-GA, NGP, IMR-5/75, GI-M-EN, CHP-212, and IMR-5.

2018-10-16 | E-MTAB-6570 | biostudies-arrayexpress

mRNA expression profiles of TAE-684 treated or shALK transfected neuroblastoma cell lines

Project description:Human wild-type ALK (SK-N-AS, NGP, IMR-32), ALKR1275Q (CLB-GA, LAN-5, UKF-NB-3), ALKF1174L (SK-N-SH, Kelly, SMS-KCNR) and ALK amplified (NB-1) neuroblastoma cell lines were treated in triplicate with 0.3M-k_M NPV-TAE-684 (Novartis/SelleckChem) or DMSO (VWR) for 6 hours, followed by RNA isolation and gene expression profiling. For shRNA mediated knockdown, pGIPZ-ALK shRNAmir and pGIPZ-non-silencing control shRNAmir vectors were used (Open Biosystems). The ALK shRNA was directed against a part of exon 26 in the tyrosine kinase domain of ALK (target sequence: TGGAAGGAATATTCACTTCTAA). Lentiviral particles were produced according to manufacturerM-^IM-[M-*s protocol (Open Biosystems). On day 2 post-transduction of neuroblastoma cells, the transduction efficiency was determined by flow cytometry and microscopic analysis of GFP-positive cells (>90% so no further selection was performed). Cells were subsequently harvested for expression profiling. Labeling of the RNA samples and hybridisation to the Affymetrix HG-U133plus2 arrays was performed using the manufacturerM-^IM-[M-*s protocol starting from 1 M-eM-5g of RNA.

2015-05-04 | E-MTAB-3205 | biostudies-arrayexpress

Integrated genome, transcriptome and translatome profiling of neuroblastoma cells

Project description:Microarray-based genome-wide measurements of copy number alterations and of transcriptome variations are proposed for neuroblastoma prognosis and possible treatment choice. Nonetheless, they lack to provide clues on a neglected layer of systems-level changes, the translatome, whose variations are defined by the activity of the translational regulatory machinery. Our study extends the conventional genome-wide approaches to translatome profiling in neuroblastoma, by means of polysomal sucrose gradient separation followed by microarray analysis. The panel of fourteen parental (not subcloned) neuroblastoma cell lines used in the study includes: CHP-134, SIMA, NB-69, LAN-1, KELLY, CHP-126, CHP-212, SK-N-BE(2), IMR-32, SK-N-AS, SK-N-SH, STA-NB-7, STA-NB-1, STA-NB-10 cells. Each cell line has been profiled with high resolution array CGH analysis for copy number changes, and for transcriptome and translatome variations. The integration of these three types of data sets obtained from the same cells can provide information on the impact in neuroblastoma of a defined pattern of genomic lesions on both transcriptional and translational alterations of gene expression.

2010-12-31 | GSE22785 | GEO

ATAC-seq in IMR-32, CLB-GA and SH-EP neuroblastoma cell lines.

Project description:ATAC-seq to define open and closed chromatin in the human IMR-32, CLB-GA and SH-EP neuroblastoma cell lines in an untreated way.

2023-02-23 | E-MTAB-12588 | biostudies-arrayexpress

Identification of SOX11 binding sites through CUT&RUN sequencing in the neuroblastoma cell lines IMR-32, CLB-GA, NGP and SH-EP

Project description:CUT&RUN sequencing to define binding sites for SOX11 and IgG in the neuroblastoma cell lines IMR-32, CLB-GA and NGP as well as neuroblastoma cell line SH-EP after SOX11 overexpression for 48h. A SOX11 inducible overexpression system was generated using a Tet-on system.

2022-12-13 | E-MTAB-11905 | biostudies-arrayexpress

Genome wide profiling of MBD2 binding

Project description:We show that in vivo MBD2 is mainly recruited to CpG island promoters that are highly methylated. We also report that MBD2 binds to a subset of CpG island promoters that are characterized by the presence of active histone marks and RNA polymerase II (Pol2). At such sites, MBD2 binds downstream of the transcription start site. Active promoters bound by MBD2 show low to medium gene expression levels and H3K36me3 deposition suggesting a putative role for MBD2 in blocking polymerase II (Pol2) elongation at these promoters.

2014-07-03 | GSE54693 | GEO

ChIP-seq of neuroblastoma IMR-32, CLB-GA, NGP, IMR-5/75, GI-M-EN, CHP-212, and IMR-5 cell lines to identify TBX2, MYCN, H3K27ac, H3K4me1 and H3K4me3 binding sites

Project description:ChIP-seq of neuroblastoma IMR-32, CLB-GA, NGP, IMR-5/75, GI-M-EN, CHP-212, and IMR-5 cell lines to identify TBX2, MYCN, H3K27ac, H3K4me1 and H3K4me3 binding sites

| PRJEB25363 | ENA

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data