Effects of Plasmodium berghei infection on Anopheles gambiae during oocysts development
Ontology highlight
ABSTRACT:
ORGANISM(S): Anopheles gambiae
PROVIDER: GSE32200 | GEO | 2011/12/31
SECONDARY ACCESSION(S): PRJNA147385
REPOSITORIES: GEO
Similar Datasets
Project description:Plasmodium ssp. are pathogens in their vertebrate hosts and also cause deleterious effects to their insect vectors. We show here, however, that Plasmodium-infected mosquitoes more efficiently accumulate energy resources (glycogen) during oocyst development, and survive better when they are starved. Microarray analysis revealed that mosquito metabolism is altered by the presence of rapidly growing oocysts in the midgut. Plasmodium infection is associated with enhanced expression of several insulin-like peptides in mosquitoes and blocking insulin-like signaling results in diminished Plasmodium development. We conclude that Plasmodium infection dramatically changes mosquito metabolism pathways, epitomized by enhanced insulin-signaling, and thereby confer a survival advantage to the insects during periods of starvation. Manipulation of this pathway may provide new strategies to influence the ability of mosquitoes to transmit the protozoa that cause malaria. One-condition experiment: P. berghei infected vs uninfected mosquitoes; 10 mosquitoes per sample; 4 biological replicates for each group; two different time points, 10 and 17 days post infection; control mosquitoes were from same batch as infected mosquitoes that were fed on clean mice.
2011-12-31 | E-GEOD-32200 | biostudies-arrayexpress
Project description:Colonization of the mosquito host by Plasmodium parasites is achieved by sexually differentiated gametocytes. Gametocytogenesis, gamete formation and fertilization are tightly regulated processes, and translational repression is a major regulatory mechanism for stage conversion. Here, we present a characterization of a Plasmodium berghei RNA binding protein, UIS12, that contains two conserved eukaryotic RNA recognition motifs (RRM). Targeted gene deletion results in viable parasites that replicate normally during blood infection, but form fewer gametocytes. Upon transmission to Anopheles stephensi mosquitoes, both numbers and size of midgut-associated oocysts are impaired. As a consequence, no salivary gland sporozoites are formed indicative of a complete life cycle arrest in the mosquito vector. Comparative transcript profiling in mutant and wild-type infected red blood cells revealed downregulation of mRNAs coding for signature gamete-, ookinete- and oocyst-specific proteins in uis12(-) parasites. Together, our findings indicate multiple roles for UIS12 in regulation of gene expression after blood infection in good agreement with the pleiotropic defects that terminate successful sporogony and onward transmission to a new vertebrate host.
2021-03-05 | GSE152686 | GEO
Project description:Plasmodium parasites within mosquitoes are exposed to various physiological processes, such as blood meal digestion activity, the gonotrophic cycle, and host responses preventing the entry of parasites into the midgut wall. However, when in vitro-cultured ookinetes are injected into the hemocoel of mosquitoes, Plasmodium parasites are not affected by the vertebrate host’s blood contents and do not pass through the midgut epithelial cells. This infection method might aid in identifying mosquito-derived factors affecting Plasmodium development within mosquitoes. This study investigated novel mosquito-derived molecules related to parasite development in Anopheles mosquitoes. We injected in vitro-cultured Plasmodium berghei (ANKA strain) ookinetes into female and male Anopheles stephensi (STE2 strain) mosquitoes and found that the oocyst number was significantly higher in males than in females, suggesting that male mosquitoes better support the development of parasites. Next, RNA-seq analysis was performed on the injected female and male mosquitoes to identify genes exhibiting changes in expression. Five genes with different expression patterns between sexes and greatest expression changes were identified as being potentially associated with Plasmodium infection. Two of the five genes also showed expression changes with infection by blood-feeding, indicating that these genes could affect the development of Plasmodium parasites in mosquitoes.
2024-05-06 | GSE197159 | GEO
Project description:To date little is known about the transcriptome of Hammondia hammondi, the nearest extant relative of Toxoplasma gondii. In this study we used an existing microarray to query Toxoplasma gondii and Hammondia hammondi transcript abundance in sporulated oocysts. Oocysts of the VEG strain of Toxoplasma gondii, and the HhCatGer041 strain of Hammondia hammondi, were isolated from cat feces by sucrose flotation, and sporulated for ~3-6 months in 2% sulfuric acid. RNA was isolated from Bleach-treated oocyst preparations using the Trizol reagent. RNA was biotinylated for hybridization to Toxo 169 Affymetrix chips using the Illumina Total Prep RNA labeling kit (Ambion). For each species 3 separate RNA isolations were performed on the same batch of oocysts and hybridized to individual microarrays.
2014-10-02 | E-GEOD-61963 | biostudies-arrayexpress
Project description:Anopheline mosquitoes transmit Plasmodium parasites to humans, and are responsible for an estimated 219 million cases of malaria, leading to over 400,000 deaths annually. The mosquito’s immune system limits Plasmodium infection in several ways, and hemocytes, the insect white blood cells, are key players in these defense responses. However, the full functional diversity of mosquito hemocytes and their developmental trajectories have not been established. We use single cell RNA sequencing (scRNA-seq) to analyze the transcriptional profiles of individual mosquito hemocytes in response to blood feeding or infection with Plasmodium. Circulating hemocytes were collected from adult A. gambiae M form (A. coluzzii) females that were either kept on a sugar meal or fed on a healthy or a Plasmodium berghei-infected mouse. Transcriptomes from 5,383 cells (collected 1, 3, and 7 days after feeding) revealed nine major cell clusters.
2020-08-27 | E-MTAB-9240 | biostudies-arrayexpress
Project description:Anopheline mosquitoes transmit Plasmodium parasites to humans, and are responsible for an estimated 219 million cases of malaria, leading to over 400,000 deaths annually. The mosquito’s immune system limits Plasmodium infection in several ways, and hemocytes, the insect white blood cells, are key players in these defense responses. However, the full functional diversity of mosquito hemocytes and their developmental trajectories have not been established. We use bulk RNA sequencing (scRNA-seq) to analyze the transcriptional profiles of hemocytes, of guts, and of carcasses of mosquito hemocytes in response to blood feeding or infection with Plasmodium. Data from three independent biological replicates for each condition and time-point (day 0, 1, 2, 3, and 7 after sugar-feeding, blood-feeding or P. berghei infection).
2020-08-27 | E-MTAB-9241 | biostudies-arrayexpress
Project description:Background: The mosquito Anopheles gambiae is a major vector of human malaria. Increasing evidence indicates that blood cells (hemocytes) comprise an essential arm of the mosquito innate immune response against both bacteria and malaria parasites. To further characterize the role of hemocytes in mosquito immunity, we undertook the first genome-wide transcriptomic analyses of adult female An. gambiae hemocytes following infection by two species of bacteria and a malaria parasite. Results: We identified 4047 genes expressed in hemocytes, using An. gambiae genome-wide microarrays. While 279 transcripts were significantly enriched in hemocytes relative to whole adult female mosquitoes, 959 transcripts exhibited immune challenge-related regulation. The global transcriptomic responses of hemocytes to challenge with different species of bacteria and/or different stages of malaria parasite infection revealed discrete, minimally overlapping, pathogen-specific signatures of infection-responsive gene expression; 105 of these represented putative immunity-related genes including anti-Plasmodium factors. Of particular interest was the specific co-regulation of various members of the Imd and JNK immune signaling pathways during malaria parasite invasion of the mosquito midgut epithelium. Conclusion: Our genome-wide transcriptomic analysis of adult mosquito hemocytes reveals pathogen-specific signatures of gene regulation and identifies several novel candidate genes for future functional studies. In order to identify hemocyte-specific and immune-responsive transcripts, we first compared transcripts expressed in hemocytes from one day old sugar-fed mosquitoes to transcripts detected in whole mosquitoes of the same age and feeding status. This resulted in identification of the hemocyte-enriched transcriptome. We then compared hemocytes from 1 day old mosquitoes, 1 hour after immune challenge with heat-killed Escherichia coli or Micrococcus luteus, to control female mosquitoes injected with sterile PBS to determine the bacteria challenge responsive transcriptomes. We used heat-killed bacteria in these assays, because our primary interest was in identifying the bacterial responsive transcriptome and to avoid the potentially confounding effects of altered gene expression due to the lethal effects of a systemic infection associated with injection of living bacteria. Lastly, we compared hemocytes from mosquitoes at 24 hours and 19 days after ingestion of a blood meal infected with Plasmodium berghei to mosquitoes of the same age fed a non-infected blood meal to determine the ookinete and sporozoite infection responsive transcriptomes, respectively. This design resulted in a total of five experimental treatments. The following samples are not included in this submission: Hemo E coli vs. hemo unchallenged A Hemo E coli vs. hemo unchallenged B Hemo m luteus vs. hemo unchallenged A Hemo m luteus vs. hemo unchallenged B
2011-10-31 | E-GEOD-33269 | biostudies-arrayexpress
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed.
2013-04-02 | GSE26941 | GEO
Project description:MalariaM-bM-^@M-^Ys cycle of infection requires parasite transmission between a mosquito vector and a vertebrate host. Plasmodium regulates transmission by translationally repressing specific mRNAs until their products are needed. We demonstrate that the Plasmodium yoelii Pumilio-FBF family member Puf2 allows the sporozoite to retain its infectivity in the mosquito salivary glands while awaiting transmission. Puf2 mediates this critical feature solely through its RNA-Binding Domain (RBD) likely by protecting and silencing specific mRNAs. Puf2 storage granules are distinct from stress granules and P-bodies and dissolve rapidly after infection of hepatocytes, likely releasing the protected and silenced transcripts for M-bM-^@M-^Xjust-in-timeM-bM-^@M-^Y translation by early exoerythrocytic forms (EEFs). Further corroborating this model, pypuf2- sporozoites have no apparent defect in host infection early after invading the salivary glands, but become progressively noninfectious and subsequently prematurely transform into EEFs during prolonged salivary gland residence. In contrast, the premature overexpression of Puf2 in oocysts causes striking deregulation of sporozoite maturation, resulting in fewer oocyst sporozoites that are non-infectious and unable to colonize the salivary glands. Maintenance of Puf2 expression in liver stage parasites produces no phenotype, suggesting that a window of permissive expression exists. Finally, by conducting the first comparative RNAseq analysis of Plasmodium sporozoites, we have uncovered that Puf2 may play a role in both the protection of specific transcripts as well as RNA turnover via the CCR4/Not complex. These findings uncover requirements for maintaining a window of opportunity for the malaria parasite to accommodate the unpredictable moment of transmission from mosquito to vertebrate host. Wild-type (Py17XNL) and pypuf2 -salivary gland sporozoites
2012-10-27 | E-GEOD-41873 | biostudies-arrayexpress
Project description:In the present study, we have investigated the effect of CpG Oligodeoxynucleotides (CpG-ODN) on the outcome of Plasmodium infection of the mosquito vectors Anopheles stephensi and Anopheles gambiae and on the modulation of mosquito immunity to Plasmodium. Anopheles mosquitoes inoculated with CpG-ODN showed significant reduction of Plasmodium infection rate and intensity. Microarrays were used to profile transcription of fat-body from CpG-ODN-treated mosquitoes. Mosquitoes were dissected 18h after ODN inoculation (immediately before feeding). Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule]) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Mosquitoes treated with CpG-ODNs are less susceptible to Plasmodium infection. Transcription profile of fat body indicates that protection was associated with coagulation/wound healing, while melanization appears to be depressed. Anopheles gambiae s.s. mosquitoes were reared at 25 M-BM-:C and 75% humidity with a 12-hour light/dark cycle. Adult mosquitoes were maintained on a 10% glucose solution. Three- to four-day-old female mosquitoes were cold-anaesthetized and inoculated intratoraxically with 69nl of a 0.1mM CpG-oligodeoxynucleotide (0604 -5M-bM-^@M-^Y TCCATGACGTTCCTGATGCT 3M-bM-^@M-^Y) solution or with the same volume of elution buffer using a Nanoject micro-injector (Drummond Scientific). Mosquitoes were left to rest for 18h. Batches of 20 to 30 fat bodies (abdomen without midgut, ovaries and malpighian tubule) were dissected in cold DEPC-treated phosphate-buffered saline (PBS) and processed for RNA preparation. Two independent experiments were performed for each treatment.
2013-04-02 | E-GEOD-26941 | biostudies-arrayexpress