Gene expression profiling of two diffuse large B-cell lymphoma (DLBCL) cell lines, DHL4 and DHL6, treated with the SYK inhibitor, R406
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE34176 | GEO | 2013/12/31
SECONDARY ACCESSION(S): PRJNA149685
REPOSITORIES: GEO
Similar Datasets
Project description:The five DLBCL cell lines were treated with R406 to assess the signature of SYK inhibition. In previous studies, R406 decreased the proliferation and induced apoptosis of these surface Ig+ cell lines. In the previous studies, R406 inhibited the autophosphorylation of SYK 525/526 and SYK-dependent phosphorylation of BCR signaling components such as BLNK.
2013-08-31 | GSE43510 | GEO
Project description:The five DLBCL cell lines were treated with R406 to assess the signature of SYK inhibition. In previous studies, R406 decreased the proliferation and induced apoptosis of these surface Ig+ cell lines. In the previous studies, R406 inhibited the autophosphorylation of SYK 525/526 and SYK-dependent phosphorylation of BCR signaling components such as BLNK. RNA samples from five DLBCL cell lines treated with R406 or vehicle (DMSO) alone for 0, 6, or 24 hours were profiled in triplicate on Affymetrix HT_HG-U133plust2 chips.
2013-08-31 | E-GEOD-43510 | biostudies-arrayexpress
Project description:The two DLBCL cell lines were treated with R406 to assess the signature of SYK inhibition. In previous studies, R406 decreased the proliferation and induced apoptosis of these surface Ig+ cell lines. In the previous studies, R406 inhibited the autophosphorylation of SYK 525/526 and SYK-dependent phosphorylation of BCR signaling components such as BLNK. RNA samples from two DLBCL cell lines, DHL4 and DHL6, treated with R406 or vehicle (DMSO) alone for 0, 2, 6, 24 or 48 hours were profiled in triplicate on Affymetrix HT_HG-U133A chips.
2013-12-31 | E-GEOD-34176 | biostudies-arrayexpress
Project description:Background: Among all gynecologic malignancies, epithelial ovarian cancer has the highest case-to-fatality ratio. Most patients are diagnosed at advanced stages and recurrence is common and accounts for disease-related mortality. Spleen tyrosine kinase (SYK) is an emerging cancer-associated kinase upregulated in recurrent tumors and is amenable for inhibition using small compounds that have been studied in clinical trials for autoimmune diseases. Our previous proteomic analysis identified several novel SYK substrates including EGFR and ERBB2. Here, we investigated the cross-talk between these pathways in ovarian carcinomas. Methods: Immunohistochemistry and immunoblotting were utilized to assess SYK and EGFR phosphorylation in ovarian serous carcinomas. Association with survival was determined by Kaplan-Meier analysis and the log-rank test. To study its role in EGFR signaling, SYK activity was modulated using a small molecule inhibitor, a syngeneic knockout, and an active kinase inducible system. We applied RNA-seq to investigate the SYK-regulated EGF-induced transcriptome. Results: Intense immunoreactivity of active pSYK(Y525/526) correlated with poor overall survival in two independent ovarian cancer cohorts. SYK directly phosphorylated EGFR and ERBB2, while knockout of SYK reduces their phosphorylation. Phosphorylation levels of SYK(Y525/526) positively correlated with EGFR(Y1187) and STAT3(Y705). Active SYK reduced sensitivity to the EGFR/ERBB2 inhibitor, lapatinib, and SYK non-phosphorylatable EGFR mutant was more sensitive to paclitaxel. SYK modulated the EGF-induced transcriptome, supporting its involvement in EGFR/ERBB2-regulated transcriptional activity. Conclusions: Our findings suggest an upstream role of SYK in regulating the EGFR/ERBB2 signaling, and provide a biological rationale for targeting SYK in ovarian cancer therapy.
2020-11-08 | GSE106716 | GEO
Project description:Small molecules not only are convenient and useful for controlling cell fates, but also can provide better understanding of the molecular mechanisms of cell-fate transitions. Here, we identified that spleen tyrosine kinase (Syk) inhibitor R406 could significantly promote the early stage of mouse chemical reprogramming. Furthermore, R406 alleviated the Syk-calcineurin (Cn)-nuclear factor of activated T cells (NFAT) signaling cascade-mediated suppression of glycine, serine and threonine metabolic genes transcriptionally, which is previously unrecognized. In turn, R406 upregulated metabolites of glycine, serine and threonine metabolism and downstream transsulfuration cysteine biosynthesis pathway and cysteine metabolism. Subsequently, increased cellular hydrogen sulfide (H2S) after R406 treatment downregulated oxidative phosphorylation (OXPHOS) and reactive oxygen species (ROS), modulated redox homeostasis, and significantly enhanced chemical reprogramming. In sum, our studies have not only improved the chemical reprogramming technique, but also identified interesting molecular mechanisms of chemical-induced pluripotent reprogramming, which hold great potentials in regenerative medicine.
2021-03-14 | GSE154687 | GEO
Project description:B cell linker protein (BLNK) is a pivotal adaptor protein that interfaces the B cell receptor (BCR)-associated spleen tyrosine kinase (Syk) to regulate B cell function and development. However, it is still not well understood whether BLNK is involved in Syk-coupled C-type lectin receptor (CLR) signaling in myeloid cells, particularly in the context of antifungal immunity. Here, we show that stimulation with fungi-derived β-glucans or α-mannans induced the phosphorylation of BLNK in macrophages, which was significantly impaired due to the deficiency of CLRs including Dectin-1 and Dectin-2, as well as their downstream mediators Syk and Fc-receptor gamma-chain (FcRγ). Furthermore, BLNK is induced to be interacted with casitas B-lineage lymphoma (c-Cbl), which is completely dependent on the engagement of Dectin-1 and Dectin-2. Notably, BLNK deficiency facilitates CLR-mediated recruitment of c-Cbl/phosphatidylinositol 3-kinase (PI3K) complex to F-actin cytoskeleton, thereby promoting macrophage migration. Consequently, mice with monocyte-specific deficiency of BLNK are highly resistant to the infection with Candida albicans, a major human fungal pathogen, through increasing the infiltration of Ly6C+macrophages into kidneys. Together, our data indicate that BLNK functions downstream of Syk-coupled CLRs to negatively regulate antifungal immunity against C. albicans infection. These findings unravel a previously unidentified role of BLNK that negatively regulates macrophage migration through inhibiting CLR-mediated recruitment of c-Cbl/PI3K complex to the cytoskeleton.
2023-11-07 | GSE246891 | GEO
Project description:Genetic studies have highlighted microglia as pivotal in orchestrating Alzheimer’s disease (AD). Microglia that adhere to Aβ plaques acquire a transcriptional signature, “diseaseassociated microglia” (DAM), which largely emanates from the TREM2-DAP12 receptor complex that transmits intracellular signals through the protein tyrosine kinase SYK. The human TREM2R47H variant associated with high AD risk fails to activate microglia via SYK. We found that SYK-deficient microglia cannot encase Aβ plaques, accelerating brain pathology and behavioral deficits. SYK deficiency impaired the PI3K-AKT-GSK3β-mTOR pathway, incapacitating anabolic support required for attaining the DAM profile. However, SYK-deficient microglia proliferated and advanced to an Apoe-expressing prodromal stage of DAM; this pathway relied on the adaptor DAP10, which also binds TREM2. Thus, microglial responses to Aβ involve non-redundant SYK- and DAP10-pathways. Systemic administration of an antibody against CLEC7A, a receptor that directly activates SYK, rescued microglia activation in mice expressing the TREM2R47H allele, unveiling new options for AD immunotherapy.
2022-10-10 | GSE195518 | GEO
Project description:Loss of Syk in normal breast cells in vivo and in vitro: gene expression and phenotypic switch to stem-cell like with induction of invadopodia Morphological and gene microarray analysis following Syk knockdown in MCF10A reveals a loss of luminal and differentiated epithelial features with epithelial to mesenchymal transition and a gain in invadopodia and stem/ progenitor cell marker expression. These results support the role of Syk in limiting normal stem/progenitor proliferation and invasion during morphogenesis, and support the role of Syk as a critical tumor suppressor for breast cancer.
2009-11-20 | GSE16200 | GEO
Project description:Cooperative dependencies between mutant oncoproteins and wild-type proteins are critical in cancer pathogenesis and therapy resistance. Although spleen tyrosine kinase (SYK) has been implicated in hematologic malignancies, it is rarely mutated. We used kinase activity profiling to identify collaborators of SYK in acute myeloid leukemia (AML) and determined that FMS-like tyrosine kinase 3 (FLT3) is transactivated by SYK via direct binding. Highly activated SYK is predominantly found in FLT3-ITD positive AML and cooperates with FLT3-ITD to activate MYC transcriptional programs. FLT3-ITD AML cells are more vulnerable to SYK suppression than FLT3 wild-type counterparts. In a FLT3-ITD in vivo model, SYK is indispensable for myeloproliferative disease (MPD) development, and SYK overexpression promotes overt transformation to AML and resistance to FLT3-ITD-targeted therapy. HL-60, MOLM-14, and U937 cell lines were transduced in triplicate with a control luciferase-directed shRNA (target sequence CCTAAGGTTAAGTCGCCCTCG), and in duplicate with two SYK-directed shRNAs: shSYK_1 (clone ID TRCN0000197257, target sequence GCAGCAGAACAGACATGTCAA) and shSYK_2 (clone ID TRCN0000003163 , target sequence GCAGGCCATCATCAGTCAGAA), and were then selected with 1 µg/ml puromycin 48 hours post-infection. At day 5 post-infection, RNA was extracted and profiled using HT HG-U133A arrays (Affymetrix) at the Broad Institute (Cambridge, MA, USA). The computational analysis of the gene expression data was performed through the Genome Space bioinformatics platform (http://www.genomespace.org).
2014-01-15 | E-GEOD-54065 | biostudies-arrayexpress
Project description:Targeted therapy studies with small molecules against kinases, such as spleen tyrosine kinase (SYK), are underway in patients with acute myeloid leukemia (AML) and show promising initial results. Identifying the potential mechanism of resistance and finding new drug combinations to overcome them, however, is essential for the long-term success of these targeted agents. Here, we conducted a genome-scale ORF resistance screen and identified activation of the RAS/MAPK/ERK signaling pathway as one major mechanism of resistance to SYK inhibition. This finding was validated in AML cell lines with innate and acquired resistance to a SYK inhibitor and in AML samples from patients who developed resistance to SYK inhibition. In order to circumvent this resistance, we demonstrate the synergistic activity of a MEK Inhibitor in combination with a SYK inhibitor in RAS mutated cells, as well as in entospletinib-resistant AML cells.
2020-01-16 | GSE129698 | GEO