Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

The histone chaperone Spt6 is required for AID target determination through H3K4me3 regulation

ABSTRACT: H3K4me3 plays a critical role in the activation-induced cytidine deaminase (AID)-induced DNA cleavage of switch (S) regions in the immunoglobulin heavy chain (IgH) locus during class-switch recombination (CSR). The histone chaperone complex facilitates chromatin transcription (FACT) is responsible for forming H3K4me3 at AID target loci. Histone chaperone suppressor of Ty6 (Spt6) also participates in regulating H3K4me3 for CSR and for somatic hypermutation (SHM) in AID target loci. H3K4me3 loss was correlated with defects in AID-induced DNA breakage and reduced mutation frequencies in IgH loci, in both S and variable regions, and in non-IgH loci, such as metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) and small nucleolar RNA host gene 3 (SNHG3). Global gene expression analysis revealed that Spt6 can act as both a positive and negative transcriptional regulator in B cells, affecting approximately 5% of the genes that includes suppressor of Ty4 (Spt4) and AID. Interestingly, Spt6 regulates CSR and AID expression through two distinct histone modification pathways, H3K4me3 and H3K36me3, respectively. Spt6 is a unique histone chaperone, capable of regulating the histone epigenetic state of both AID targets and the AID locus.

ORGANISM(S): Mus musculus

PROVIDER: GSE35334 | GEO | 2013/02/01

SECONDARY ACCESSION(S): PRJNA152649

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

The histone chaperone Spt6 is required for AID target determination through H3K4me3 regulation

Project description:H3K4me3 plays a critical role in the activation-induced cytidine deaminase (AID)-induced DNA cleavage of switch (S) regions in the immunoglobulin heavy chain (IgH) locus during class-switch recombination (CSR). The histone chaperone complex facilitates chromatin transcription (FACT) is responsible for forming H3K4me3 at AID target loci. Histone chaperone suppressor of Ty6 (Spt6) also participates in regulating H3K4me3 for CSR and for somatic hypermutation (SHM) in AID target loci. H3K4me3 loss was correlated with defects in AID-induced DNA breakage and reduced mutation frequencies in IgH loci, in both S and variable regions, and in non-IgH loci, such as metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) and small nucleolar RNA host gene 3 (SNHG3). Global gene expression analysis revealed that Spt6 can act as both a positive and negative transcriptional regulator in B cells, affecting approximately 5% of the genes that includes suppressor of Ty4 (Spt4) and AID. Interestingly, Spt6 regulates CSR and AID expression through two distinct histone modification pathways, H3K4me3 and H3K36me3, respectively. Spt6 is a unique histone chaperone, capable of regulating the histone epigenetic state of both AID targets and the AID locus. CH12F3-2A cells were transfected with control and Spt6 siRNAs; 24h later, cells were stimulated with CIT to induce CSR. Total RNA was extracted from control and Spt6 siRNA treated cells for mRNA expression profiling.

2013-02-01 | E-GEOD-35334 | biostudies-arrayexpress

Genome-wide localization of Smc1, Smc3 and CTCF in mouse B cells.

Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to switch regions and by the subsequent generation and resolution of dsDNA breaks (DSBs). During, CSR the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and switch regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we show that during CSR, AID associates with subunits of cohesin, a complex previously implicated in DNA repair and in the formation of DNA loops between enhancers and promoters. By ChIP-Seq experiments, we find that Cohesin is dynamically recruited to the IgH locus during CSR and that knockdown of Cohesin or its regulatory subunits results in impaired CSR and abnormal DSB resolution. Our results are consistent with a model in which Cohesin controls the formation of long-range DNA loops at the IgH locus and the resolution of DSBs generated during CSR. Smc1, Smc3 and CTCF were immunoprecipitated from resting or in vitro activated B cells.

2013-10-11 | E-GEOD-43594 | biostudies-arrayexpress

Acetylated Histone Reader Brd4 functions as Repair Adaptor in Immunoglobulin Class Switch Recombination

Project description:Class Switch Recombination (CSR) is a B cell specific genomic alteration induced by activation induced cytidine deaminase (AID)-dependent DNA break, followed by repair and recombination at the immunoglobulin heavy-chain locus. The involvement of several chromatin-associated factors in promoting AID-induced DNA break formation has been reported. However, the involvement of chromatin adaptors at the repair phase of CSR remains unknown. Here, we provide evidence that acetylated histone reader Brd4 is critical to the repair and recombination step of CSR. Brd4 was recruited to the AID-induced DNA break region, and depletion of Brd4 from the S region chromatin by knockdown or a chemical inhibitor JQ1 causes CSR impairment without affecting AID-induced DNA break generation. Such inhibition of Brd4 suppressed the accumulation of 53BP1 and UNG at the cleaved S regions, perturbed switch donor-switch acceptor microhomology length and reduced Igh/c-myc translocation. We conclude that Brd4 serves as a histone-reader platform required for the recruitment of CSR repair components. Brd4 were depleted from the chromatin by either siRNA treatment or JQ1 (40nM) addition in CH12F3-2A cells in the presence of CIT stimulation. RNA from each samples were extracted and relative difference in transcript level were compared with control RNAi- and DMSO-treated, CIT-stimulated samples.

2014-06-20 | E-GEOD-52239 | biostudies-arrayexpress

Acetylated Histone Reader Brd4 functions as Repair Adaptor in Immunoglobulin Class Switch Recombination

2014-06-20 | GSE52239 | GEO

High-throughput sequencing of genome-wide translocations from stimulated wild-type or ATM-deficient B cells

Project description:High-throughput genome-wide translocation sequencing (HTGTS) is a robust approach to identify genome-wide translocation junctions. We performed HTGTS to study the fate of introduced c-myc DSBs in mouse splenic B cells activated for activation cytidine deaminase (AID)-dependent class switch recombination (CSR). We found frequent translocations of c-myc DSBs to AID-initiated DSBs in IgH switch regions in wild-type (WT) and ATM-deficient B cells. However, c-myc also translocated frequently to newly generated DSBs within a 35-megabase region downstream of IgH in ATM-deficient, but not WT, CSR-activated B cells. Moreover, we found such DSBs and translocations in activated B cells that did not express AID or undergo CSR. These findings indicate that ATM deficiency leads to formation of chromosome 12 dicentrics via RAG-initiated IgH DSBs in progenitor B cells and that these dicentrics can be propagated developmentally into mature B cells where they generate new DSBs downstream of IgH via breakage-fusion-bridge cycles. Preparation of libraries from WT or ATM-deficient activated by a-CD40/IL4 or RP105.

2014-06-18 | E-GEOD-58599 | biostudies-arrayexpress

PTIP promotes chromatin changes critical for immunoglobulin class switch recombination

Project description:Programmed genetic rearrangements in lymphocytes require transcription at antigen receptor genes to promote accessibility for initiating double-strand break (DSB) formation critical for DNA recombination and repair. Here we show that activated B cells deficient in the PTIP component of the MLL3 (mixed-lineage leukemia 3) /MLL4 complex display impaired histone methylation (H3K4me3) and transcription initiation of downstream switch regions at the immunoglobulin heavy-chain (Igh) locus leading to defective immunoglobulin class-switching. We also show that PTIP accumulation at DSBs contributes to class-switch recombination (CSR) and genome stability independently from Igh switch transcription. These results demonstrate that PTIP promotes specific chromatin changes that control the accessibility of the Igh locus to CSR, and suggest a non-redundant role for the MLL3/MLL4 complex in altering antibody effector function. Genome-wide analysis of histone modifications, PTIP, and Pol II in PTIP-WT and PTIP-KO mouse activated B cells.

2010-08-25 | E-GEOD-20852 | biostudies-arrayexpress

Genome-wide localization of Smc1, Smc3 and CTCF in mouse B cells.

2013-10-11 | GSE43594 | GEO

Med1 facilitates transcriptional activation and dynamic long-range contacts at the IgH locus during class switch recombination.

Project description:Immunoglobulin class switch recombination (CSR) is initiated by the transcription-coupled recruitment of activation induced cytidine deaminase (AID) to immunoglobulin switch (S) regions. During CSR, the IgH locus undergoes dynamic three-dimensional structural changes in which promoters, enhancers and S regions are brought to close proximity. Nevertheless, little is known about the underlying mechanisms. Here we conditionally inactivated in B cells the Med1 subunit of mediator, a complex implicated in transcription initiation and long-range enhancer/promoter loop formation. We find that Med1-deficiency results in defective CSR, reduced acceptor switch region transcription and that this correlates with reduced long-range interactions between the acceptor switch regions and the Em enhancer, as determined by 4C-Seq. Our results implicate the mediator complex in the mechanism of CSR and are consistent with a model in which Med1 facilitates the transcriptional activation of switch regions and their long-range contacts with the IgH locus enhancers during CSR. 4C-seq data in resting and activated WT and Med1 mutant B cells. 4C bait was designed in the Eu enhancer of the Igh locus on chromosome 12. Primer sequences: 5â TCTGTCCTAAAGGCTCTGAGA 3â and 5â GAACACAGAAGTATGTGTATGGA 3â.

2016-02-17 | E-GEOD-62969 | biostudies-arrayexpress

Distinct requirements of CHD4 during B cell development and antibody response

Project description:Immunoglobulin heavy chain (Igh) class switch recombination (CSR) requires B cell proliferation, germline transcription, AID-instigated generation of DNA double strand breaks and DNA end-joining. How these various DNA-protein interactions and DNA transactions at Igh occur within the context of the chromatin landscape are largely unknown. Histone post-translational modifications can modulate chromatin accessibility and one such epigenetic mark, H3K9me3 is present at activated Igh switch sequences that serve as recombination targets during CSR. The chromatin remodeling protein CHD4 binds H3K9me3 and shapes chromatin accessibility and gene expression in various cell types, but its role in B cell biology is yet to be elucidated. Here, we conditionally ablated CHD4 expression in different stages of B cell development. We find that while CHD4 is essential for early B cell development, it is dispensable for homeostatic maintenance of mature naïve B cells and differentiation into antigen-specific early memory B cells and plasmablasts. However, loss of CHD4 in activated B cells leads to a severe defect in CSR, accompanied by markedly impaired cellular proliferation. Conditional deletion of p53 rescued the proliferation defect but failed to restore CSR due to a failure of AID to be efficiently recruited to Igh. This work unmasks a context-dependent role of CHD4 in B cell development and identifies CHD4 as a novel effector of CSR that influences B cell proliferation and recruitment of AID to Igh.

2019-05-29 | GSE128321 | GEO