Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

ETV1 and ERG genome binding/occupancy profiling by genome tiling array

ABSTRACT: Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. How these factors contribute to tumorigenesis and whether they play similar in vivo roles remain elusive. We show that ERG and ETV1 control a common transcriptional network but in an opposing fashion. In mice with ERG or ETV1 targeted to the endogenous Tmprss2 locus, either factors cooperated with Pten-loss, leading to localized cancer, but only ETV1 supported development of advanced adenocarcinoma, likely through enhancement of androgen receptor signaling and steroid biosynthesis. Indeed, ETV1 expression promotes autonomous testosterone production, which may contribute to tumor progression to castration-resistant prostate cancer. Patient data confirmed association of ETV1 expression with aggressive disease. We conclude that despite many shared targets, ERG and ETV1 contribute differently to prostate tumor biology. Hence, prostate cancers with these fusions should be considered as distinct subtypes for patient stratification and therapy.

ORGANISM(S): Homo sapiens

PROVIDER: GSE39357 | GEO | 2013/03/01

SECONDARY ACCESSION(S): PRJNA170748

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

ETV1 and ERG genome binding/occupancy profiling by genome tiling array

Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. How these factors contribute to tumorigenesis and whether they play similar in vivo roles remain elusive. We show that ERG and ETV1 control a common transcriptional network but in an opposing fashion. In mice with ERG or ETV1 targeted to the endogenous Tmprss2 locus, either factors cooperated with Pten-loss, leading to localized cancer, but only ETV1 supported development of advanced adenocarcinoma, likely through enhancement of androgen receptor signaling and steroid biosynthesis. Indeed, ETV1 expression promotes autonomous testosterone production, which may contribute to tumor progression to castration-resistant prostate cancer. Patient data confirmed association of ETV1 expression with aggressive disease. We conclude that despite many shared targets, ERG and ETV1 contribute differently to prostate tumor biology. Hence, prostate cancers with these fusions should be considered as distinct subtypes for patient stratification and therapy. Genomic targets of ERG and ETV1 transcription factors were identified by antibody-mediated and biotin-mediated ChIP-chip in human VCaP and LNCaP cells, respectively.

2013-03-01 | E-GEOD-39357 | biostudies-arrayexpress

Expression profiling of mouse primary prostate luminal cells from WT and T-ETV1 mice, which contains human ETV1 cDNA under the endogenous Tmprss2 promoter.

2013-03-01 | GSE39355 | GEO

Expression profiling of mouse primary prostate luminal cells from WT and T-ETV1 mice, which contains human ETV1 cDNA under the endogenous Tmprss2 promoter.

Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine mouse prostate cells from WT mice with s with T-ETV1 mice, which contains express the truncated human ETV1 under the endogenous Tmprss2 promoter. ETV1 expression can be tracked by GFP expression. Primary prostate cells were isolated and luminal prostate cells were FACS-sorted by CD49F+ Sca1- from the lineage (CD31, CD45, Ter119) negative fraction. Total RNA was extracted from three biological replicates, and amplified using NuGEN V2cDNA amplification kit. This was used to hybridize to Affymetrix expression arrays using the Mouse Genome 430 2.0 platform.

2013-03-01 | E-GEOD-39355 | biostudies-arrayexpress

Expression profiling of human prostate non-tumorigenic RWPE-1 cells after overexpressing ERG and ETV1, and ERG and ETV1 silencing on prostate cancer cells LNCaP and VCaP, respectively

2013-03-01 | GSE39353 | GEO

Expression profiling of human prostate VCaP and LNCaP cancer cells after silencing ERG or ETV1, respectively

2013-03-01 | GSE39354 | GEO

Expression profiling of human prostate non-tumorigenic RWPE-1 cells after overexpressing ERG and ETV1, and ERG and ETV1 silencing on prostate cancer cells LNCaP and VCaP, respectively

Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine human prostate non-tumorigenic RWPE-1 cells with ERG- or ETV1-expressing stable RWPE-1 cell. RWPE-1 stable cell clones overexpressing ERG and ETV1 were grown under normal conditions. Total RNA was extracted from three biological replicates. This was used to hybridize to Affymetrix expression arrays using the HG-U133 Plus 2.0 platform.

2013-03-01 | E-GEOD-39353 | biostudies-arrayexpress

Expression profiling of human prostate VCaP and LNCaP cancer cells after silencing ERG or ETV1, respectively

Project description:Chromosomal rearrangements involving ETS factors, ERG and ETV1, occur frequently in prostate cancer. We here examine human prostate cancer cells control VCaP and LNCaP cells with ERG- or ETV1-silenced VCaP or LNCaP cells, respectively, in hormone deprived and stimulated conditions. VCAP and LNCaP cells, 24 hr after ERG or ETV1 RNA interference, respectively, were grown in hormone-depleted conditions for 2 days, and then in the presence of EtOH (vehicle) or 10nM DHT for 16hr. Total RNA was extracted from three biological replicates. This was used to hybridize to Affymetrix expression arrays using the HG-U133 Plus 2.0 platform.

2013-03-01 | E-GEOD-39354 | biostudies-arrayexpress

The CIC-ERF co-deletion underlies fusion independent activation of ETS family member, ETV1, to drive prostate cancer progression.

Project description:Methods: To characterize the expression profile of ERF-CIC deleted prostate cells, we performed single-cell RNA-sequencing of PNT2 ERF knock down and CIC knockout cell line. Results: We found that CIC and ERF loss were significantly associated with the ETV1-regulated gene set but was anti-correlated with the TMPRSS2-ERG fusion signature gene set. The enrichment gene signature of ERF-CIC dual loss was similar to ERF loss alone and ETV1-regulated gene set signature. Conclusions: Our results provide relevant insights about a new subtype of prostate cancer with ERF and CIC codeletion

2022-10-24 | GSE216318 | GEO

Expression data from LNCap cell line treated with COP1 (RFWD2), ETV1, and JUN siRNAs

Project description:The proto-oncogenes ETV1, ETV4, and ETV5 encode members of the E26 transformation-specific (ETS) transcription factor family, which includes the most frequently rearranged and overexpressed genes in prostate cancer. Despite being critical regulators of development, little is known about their post-translational regulation. Here we identify the ubiquitin ligase COnstitutive Photomorphogenic-1 (COP1, also called RFWD2) as a tumor suppressor that negatively regulates ETV1, ETV4, and ETV5. ETV1, which is the member mutated more frequently in prostate cancer, was degraded after being ubiquitinated by COP1. Truncated ETV1 encoded by prostate cancer translocation TMPRSS2:ETV1 lacks the critical COP1 binding motifs (degrons) and was 50-fold more stable than wild-type ETV1. Almost all patient translocations eliminate these ETV1 degrons, implying that translocations rendering ETV1 insensitive to COP1 confer a significant selective advantage to prostate epithelial cells. Indeed, COP1 deficiency in mouse prostate elevated ETV1 levels and produced increased cell proliferation, hyperplasia, and early prostate intraepithelial neoplasia. The combined loss of COP1 and PTEN enhanced the invasiveness of mouse prostate adenocarcinomas. Finally, relatively rare human prostate cancer samples showed hemizygous loss of the COP1 gene, loss of COP1 protein expression, and abnormally elevated ETV1 protein while lacking a translocation event. These findings identify COP1 as a bona fide tumor suppressor whose down-regulation promotes prostatic epithelial cell proliferation and tumorigenesis.

2011-04-08 | GSE27914 | GEO

Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells

Project description:Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes.

2013-05-10 | GSE46329 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data