Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Functional analysis of Arabidopsis ARGONAUTE1 using a slicer-defective mutant: Transcript immunoprecipitation

ABSTRACT: The Arabidopsis ARGONAUTE (AGO) protein AGO1 associates with microRNA (miRNA) and specific classes of short-interfering RNA (siRNA). AGO1-small RNA complexes recognize target RNA transcripts through base-pairing interactions and inhibit translation of target RNAs through endonucleolytic cleavage (slicing) or non-degradative mechanisms. The PIWI domain of AGO1 contains a metal-coordinating triad [Asp-Asp-His] (DDH) that is required for slicer activity. Here, we compared the activities of wild type (DDH) and slicer active-site defective (DAH) forms of AGO1 by sequencing small RNA and target transcript RNAs that co-immunoprecipitated with hemagglutinin (HA)-tagged AGO1 proteins. We found that the population of miRNA that associated with both AGO1-DDH and AGO1-DAH proteins largely overlapped, suggesting that cleavage activity does not affect miRNA maturation. In contrast, slicer-defective AGO1-miRNA complexes associated with target RNA more effectively than did wild type AGO1-miRNA. These data indicate that slicer-defective AGO proteins can be used as an approach to capture AGO-small RNA-target RNA ternary complexes more efficiently for genome-wide analyses.

ORGANISM(S): Arabidopsis thaliana

PROVIDER: GSE40256 | GEO | 2012/09/28

SECONDARY ACCESSION(S): PRJNA173788

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Functional analysis of Arabidopsis ARGONAUTE1 using a slicer-defective mutant: Small RNA immunoprecipitation

Project description:The Arabidopsis ARGONAUTE (AGO) protein AGO1 associates with microRNA (miRNA) and specific classes of short-interfering RNA (siRNA). AGO1-small RNA complexes recognize target RNA transcripts through base-pairing interactions and inhibit translation of target RNAs through endonucleolytic cleavage (slicing) or non-degradative mechanisms. The PIWI domain of AGO1 contains a metal-coordinating triad [Asp-Asp-His] (DDH) that is required for slicer activity. Here, we compared the activities of wild type (DDH) and slicer active-site defective (DAH) forms of AGO1 by sequencing small RNA and target transcript RNAs that co-immunoprecipitated with hemagglutinin (HA)-tagged AGO1 proteins. We found that the population of miRNA that associated with both AGO1-DDH and AGO1-DAH proteins largely overlapped, suggesting that cleavage activity does not affect miRNA maturation. In contrast, slicer-defective AGO1-miRNA complexes associated with target RNA more effectively than did wild type AGO1-miRNA. These data indicate that slicer-defective AGO proteins can be used as an approach to capture AGO-small RNA-target RNA ternary complexes more efficiently for genome-wide analyses. AGO1-DDH (wild type) AGO1-DAH (slicer mutant) proteins were immunoprecipitated (N-terminal 3xHA) from Arabidopsis (Columbia) flower (stages 1-12) lysate. Immunoprecipitations were also done from control plants transformed with vector only. Small RNA from immunoprecipitate fractions of vector, AGO1-DDH and AGO1-DAH were sequenced.

2012-09-28 | E-GEOD-40258 | biostudies-arrayexpress

Functional analysis of Arabidopsis ARGONAUTE1 using a slicer-defective mutant: Small RNA immunoprecipitation

2012-09-28 | GSE40258 | GEO

Functional analysis of Arabidopsis ARGONAUTE1 using a slicer-defective mutant: Transcript immunoprecipitation

Project description:The Arabidopsis ARGONAUTE (AGO) protein AGO1 associates with microRNA (miRNA) and specific classes of short-interfering RNA (siRNA). AGO1-small RNA complexes recognize target RNA transcripts through base-pairing interactions and inhibit translation of target RNAs through endonucleolytic cleavage (slicing) or non-degradative mechanisms. The PIWI domain of AGO1 contains a metal-coordinating triad [Asp-Asp-His] (DDH) that is required for slicer activity. Here, we compared the activities of wild type (DDH) and slicer active-site defective (DAH) forms of AGO1 by sequencing small RNA and target transcript RNAs that co-immunoprecipitated with hemagglutinin (HA)-tagged AGO1 proteins. We found that the population of miRNA that associated with both AGO1-DDH and AGO1-DAH proteins largely overlapped, suggesting that cleavage activity does not affect miRNA maturation. In contrast, slicer-defective AGO1-miRNA complexes associated with target RNA more effectively than did wild type AGO1-miRNA. These data indicate that slicer-defective AGO proteins can be used as an approach to capture AGO-small RNA-target RNA ternary complexes more efficiently for genome-wide analyses. AGO1-DDH (wild type) AGO1-DAH (slicer mutant) proteins were immunoprecipitated (N-terminal 3xHA) from Arabidopsis (Columbia) flower (stages 1-12) lysate. Immunoprecipitate fractions were treated with nuclease P1 before cleanup to trim free RNA ends, and therefore enrich samples in AGO1 target sites. All samples were treated with Ribominus (Life Technologies) to reduce ribosomal RNA abundance. Transcript fragments from two replicates of AGO1-DDH and AGO1-DAH immunoprecipitates were sequenced. Ribominus-treated total RNA (input controls) was also sequenced for each replicate.

2012-09-28 | E-GEOD-40256 | biostudies-arrayexpress

Distinct Functions of Argonaute Slicer in siRNA Maturation and Heterochromatin Formation

Project description:Small-RNA (sRNA)-guided transcriptional gene silencing by Argonaute (Ago)-containing complexes is fundamental to genome integrity and epigenetic inheritance. The RNA cleavage (“Slicer”) activity of Argonaute has been implicated in both sRNA maturation and target RNA cleavage. Typically, Argonaute slices and releases the passenger strand of duplex sRNA to generate active silencing complexes, but it remains unclear whether slicing of target nascent RNAs, or other RNAi components, also contributes to downstream transcriptional silencing. Here, we develop a strategy for loading the fission yeast Ago1 with a single-stranded sRNA guide, which bypasses the requirement for slicer activity in generation of active silencing complexes. We show that slicer-defective Ago1 can mediate secondary sRNA generation, H3K9 methylation, and silencing similar to or better than wild-type and associates with chromatin more efficiently. The results define an ancient and minimal sRNA-mediated chromatin silencing mechanism, which resembles the germline-specific sRNA-dependent transcriptional silencing pathways in Drosophila and mammals. This SuperSeries is composed of the SubSeries listed below.

2016-12-19 | GSE81734 | GEO

Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection

Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.

2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress

Slicer activity of Arabidopsis AGO1 in siRNA biogenesis and miRNA target decay

Project description:Aim of study The objective of these studies was to analyze the implication of slicer activity of AGO1 in the following molecular processes: loading of siRNAs and miRNAs stability of siRNAs and miRNAs formation of RDR6/SGS3-dependent secondary siRNAs decay of mRNAs targeted by miRNAs The studies use point mutants defective in slicer activity and analyses total and AGO1-bound small RNA populations as well as mRNA populations in these mutants by next-generation sequencing.

2016-09-05 | E-MTAB-4529 | biostudies-arrayexpress

Slicing-Independent RISC Activation Requires the Argonaute PAZ Domain

Project description:Small RNAs regulate the genetic networks through a ribonucleoprotein complex called the RNA induced silencing complexes (RISC), which in mammals contains at its center one of four Argonaute proteins (Ago1-4). A key regulatory event in the RNAi and miRNA pathways is Ago loading, where double stranded small RNA duplexes are incorporated into RISC (pre-RISC) and then become single stranded (mature-RISC), a process that is not well understood. The Agos contain an evolutionary conserved PAZ (Piwi/Argonaute/Zwille) domain whose primary function is to bind the 3’-end of small RNAs. We created multiple Paz domain disrupted Ago mutant proteins and studied their biochemical properties and biological functionality in cells. We found that the Paz domain is dispensable for Ago loading of slicing-competent RISC. In contrast, in the absence of slicer activity or slicer substrate duplex RNAs, Paz-disrupted Agos bound duplex siRNAs but were unable to unwind/eject the passenger strand and form functional RISC complexes. We have discovered that the highly conserved Paz domain plays an important role in RISC activation, providing new mechanistic insights into how miRNAs regulate genes, as well as new insights for future design of miRNA and RNAi-based therapeutics.

2012-07-12 | GSE39146 | GEO

Slicing-Independent RISC Activation Requires the Argonaute PAZ Domain

2012-07-12 | E-GEOD-39146 | biostudies-arrayexpress

Arabidopsis AGO1 N-terminal extension acts as an essential hub for PRMT5 interaction and post-translational modifications

Project description:Plant ARGONAUTE (AGO) proteins play pivotal roles in gene expression regulation through small (s)RNA-guided mechanisms. Among the ten AGO proteins in Arabidopsis thaliana, AGO1 stands out as the main effector of post-transcriptional gene silencing. Intriguingly, a specific region of AGO1, its N-terminal extension (NTE), has gained prominence in recent studies linked to diverse regulatory functions, including subcellular localization, sRNA loading, and interactions with regulatory factors. In the realm of post-translational modifications (PTMs), little is known about arginine methylation in Arabidopsis AGOs. This study reveals a novel and intricate landscape of AGO1 methylation. Here, we have elucidated that NTEAGO1 undergoes symmetric arginine dimethylation on specific residues, and interacts with the methyltransferase PRMT5, which catalyzes its methylation. Notably, we observed that the lack of symmetric dimethylarginine has no discernible impact on AGO1's subcellular localization or miRNA loading capabilities. However, the absence of PRMT5 significantly alters the loading of a subgroup of sRNAs into AGO1 and reshapes the NTEAGO1 interactome. Importantly, our research extends beyond AGO1, illustrating that symmetric arginine dimethylation of NTEs is a common process across Arabidopsis AGOs, taking place in AGO1, AGO2, AGO3, and AGO5, deepening our understanding of PTMs in the intricate landscape of RNA-associated gene regulation.

2024-05-22 | PXD049971 | Pride

Profiling of small RNA populations in rice total extract and purified AGO1 complexes

Project description:microRNAs (miRNAs) are a class of small silencing RNAs that have regulatory roles in gene expression. miRNAs interact with Argonaute (AGO) proteins to form effector complexes that can cleave target mRNAs or repress their translation. Rice encodes four AGO1 homologs (AGO1a, AGO1b, AGO1c, and AGO1d). We used an RNAi approach to knock down the four AGO1s. The RNAi lines displayed pleiotropic developmental phenotypes and had increased accumulation of miRNA targets, suggesting the involvement of AGO1s in the miRNA pathway. Three of the AGO1s (AGO1a, AGO1b, and AGO1c complexes) were purified and further characterized. We showed that the three AGO1s all have a strong preference for binding small RNAs (sRNAs) with 5’ U and have Slicer activity. We catalogued the sRNAs in each AGO1 complex by deep sequencing, and found all three AGO1s predominantly bound known miRNAs. Most of the miRNAs were evenly distributed in the three AGO1 complexes, suggesting a redundant role for the AGO1s in the function of these miRNAs. Intriguingly, we also found a subset of miRNAs were specifically incorporated into or excluded from one of the AGO1s, suggesting that there is also functional specialization among the rice AGO1s. Four samples, total extract and three AGO1 complexes were analyzed

2009-11-23 | E-GEOD-18250 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data