Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Transcriptome analysis of Traf6 function in early zebrafish embryogenesis

ABSTRACT: In order to study Traf6 function during early zebrafish embryogenesis, transcriptome expression profiling was performed at 30% epiboly using a morpholino based knock-down approach.

ORGANISM(S): Danio rerio

PROVIDER: GSE42856 | GEO | 2013/12/01

SECONDARY ACCESSION(S): PRJNA183692

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Transcriptome analysis of Traf6 function in early zebrafish embryogenesis

Project description:In order to study Traf6 function during early zebrafish embryogenesis, transcriptome expression profiling was performed at 30% epiboly using a morpholino based knock-down approach. Two-factorial design with the factors 'Treatment' (5 levels:'Phenol Red', 'Standard Control', 'Mismatch', 'Morpholino1' and Morpholino 2') and 'Dose' (3 levels: 'Low', 'Middel' and 'High') with the factor 'Dose' only being applicable to the morpholino injections and not to the 'Phenol Red' control.

2013-12-01 | E-GEOD-42856 | biostudies-arrayexpress

Traf6 function in the innate immune response of zebrafish embryos

Project description:Transcriptional profiling of the zebrafish embryonic host response to a systemic bacterial infection with Salmonella typhimurium (strain SL1027); comparison between traf6 knock-down and control morpholino treated embryos. Two-way factorial dual colour design with factor 1 'infection with Salmonella enterica serovar Typhimurium (S. typhimurium)' and factor 2 'morpholino knock-down of traf6' using a common reference made from the sample pool. All infection experiments were performed using mixed egg clutches of ABxTL strain zebrafish. Embryos injected with traf6 morpholino or a 5bp mismatch control morpholino were staged at 27 hours post fertilization (hpf) by morphological criteria and approximately 250 cfu of DsRed expressing Salmonella bacteria were injected into the caudal vein close to the urogenital opening. As a control an equal volume of PBS was likewise injected. Pools of 20-40 infected and control embryos were collected 8 hours post infection (hpi). For the microarray analysis, the whole procedure was preformed in triplicate on separate days. The triplicates are marked 1,2 and 3.

2010-08-01 | E-GEOD-20310 | biostudies-arrayexpress

Traf6 function in the innate immune response of zebrafish embryos

2010-08-01 | GSE21024 | GEO

Traf6 function in the innate immune response of zebrafish embryos

2010-08-01 | GSE20310 | GEO

Traf6 function in the innate immune response of zebrafish embryos

Project description:Transcriptional profiling of the zebrafish embryonic host response to a systemic bacterial infection with Salmonella typhimurium (strain SL1027); comparison between traf6 knock-down and control morpholino treated embryos. All infection experiments were performed using mixed egg clutches of ABxTL strain zebrafish. Embryos injected with traf6 morpholino or a 5bp mismatch control morpholino were staged at 27 hours post fertilization (hpf) by morphological criteria and approximately 250 cfu of DsRed expressing Salmonella bacteria were injected into the caudal vein close to the urogenital opening. As a control an equal volume of PBS was likewise injected. Pools of 20-40 infected and control embryos were collected 8 hours post infection (hpi). The whole procedure was preformed in triplicate on separate days. Total RNA of the biological triplicates was pooled using equal amounts of RNA prior to RNAseq library preparation.

2010-08-01 | E-GEOD-21024 | biostudies-arrayexpress

Identification of differentially-expressed genes between FoxH1 morpholino and control in zebrafish embryos.

Project description:The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.

2007-07-30 | GSE8076 | GEO

Uncoupled H3K9me3 nucleation and reinforcement during early zebrafish embryogenesis

Project description:Uncoupled H3K9me3 nucleation and reinforcement during early zebrafish embryogenesis

| PRJNA1078867 | ENA

Chromatin architecture transitions from zebrafish sperm through early embryogenesis

Project description:Chromatin architecture transitions from zebrafish sperm through early embryogenesis

| PRJNA640309 | ENA

RNA-seq of mondoa zebrafish morphants

Project description:The glucose-sensing Mondo pathway regulates expression of metabolic genes in mammals. Here, we have revealed an unexpected role of this pathway in vertebrate embryonic development. We characterized Mondo pathway function in the zebrafish and showed that knock-down of mondoa impaired the early morphogenetic movement of epiboly in zebrafish embryos. Expression of nsdhl , an enzyme of cholesterol and pregnenolone synthesis, was strongly reduced in these embryos. Loss of Nsdhl function likewise impaired epiboly and led to microtubule cytoskeleton defects in the embryo, similar to MondoA loss of function. Both epiboly and microtubule cytoskeleton defects were partially restored by pregnenolone treatment. Gene disruption of mondoa perturbed epiboly with only partial penetrance, likely due to compensatory changes in the expression of cholesterol/steroid metabolism genes. Collectively, our results show a novel role for MondoA in the regulation of early vertebrate development, connecting glucose, cholesterol and steroid hormone metabolism with early embryonic cell movements.

2020-09-11 | GSE144349 | GEO

RNA-seq of mondoa zebrafish mutants

2020-09-11 | GSE134778 | GEO