Determination of the spatial organization of the FXN gene locus by using Chromosome Conformation Capture technique coupled with High-throughtput sequencing (3C-seq).
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE42961 | GEO | 2013/12/16
SECONDARY ACCESSION(S): PRJNA183944
REPOSITORIES: GEO
Similar Datasets
Project description:Accumulating data from different groups have demonstrated that alteration of post-translational histone modifications is an important underlying mechanism for FXN silencing in FRDA. The relationship between chromatin architecture and histone modification marks in the FXN gene locus is likely to be important for understanding the silencing mechanism. We therefore investigated the spatial organization of the FXN gene locus using the 3C-sequencing method. EBV transformed lymphoblastoid cell lines derived from patients (GM15850, GM16234 and GM16798) and Healthy control (GM14664 and GM15851) were used for generating 3C-seq libraries.
2013-12-16 | E-GEOD-42961 | biostudies-arrayexpress
Project description:We set out to investigate whether a histone deacetylase inhibitor (HDACi) would be effective in an in vitro model for the neurodegenerative disease Friedreich ataxia (FRDA) and to evaluate safety and surrogate markers of efficacy in a phase I clinical trial in patients. In the neuronal cell model, HDACi 109/RG2833 increases FXN mRNA levels and frataxin protein, with concomitant changes in the epigenetic state of the gene. Chromatin signatures indicate that histone H3 lysine 9 is a key residue for gene silencing through methylation and reactivation through acetylation, mediated by the HDACi. Drug treatment in FRDA patients demonstrated increased FXN mRNA and H3 lysine 9 acetylation in peripheral blood mononuclear cells. No safety issues were encountered. We used a human FRDA neuronal cell model, derived from patient induced pluripotent stem cells, to determine the efficacy of a 2-aminobenzamide HDACi (109) as a modulator of FXN gene expression and chromatin histone modifications. FRDA patients were dosed in 4 cohorts, ranging from 30mg/day to 240mg/day of the formulated drug product of HDACi 109, RG2833. Patients were monitored for adverse effects as well as for increases in FXN mRNA, frataxin protein, and chromatin modification in blood cells. Gene expression profiles were obtained using the Illumina HT12v4 Gene Expression BeadArray.
2015-01-29 | E-GEOD-65399 | biostudies-arrayexpress
Project description:The molecular mechanisms of reduced frataxin (FXN) expression in Friedreich's ataxia (FRDA) are linked to epigenetic modification of the FXN locus caused by the disease-associated GAA expansion. Here, we identify that SUV4-20 histone methyltransferases, specifically SUV4-20 H1, play an important role in the regulation of FXN expression and represent a novel therapeutic target. Using a human FXN-GAA-Luciferase repeat expansion genomic DNA reporter model of FRDA, we screened the Structural Genomics Consortium epigenetic probe collection. We found that pharmacological inhibition of the SUV4-20 methyltransferases by the tool compound A-196 increased the expression of FXN by ∼1.5-fold in the reporter cell line. In several FRDA cell lines and patient-derived primary peripheral blood mononuclear cells, A-196 increased FXN expression by up to 2-fold, an effect not seen in WT cells. SUV4-20 inhibition was accompanied by a reduction in H4K20me2 and H4K20me3 and an increase in H4K20me1, but only modest (1.4-7.8%) perturbation in genome-wide expression was observed. Finally, based on the structural activity relationship and crystal structure of A-196, novel small molecule A-196 analogs were synthesized and shown to give a 20-fold increase in potency for increasing FXN expression. Overall, our results suggest that histone methylation is important in the regulation of FXN expression and highlight SUV4-20 H1 as a potential novel therapeutic target for FRDA.
2020-10-08 | GSE145115 | GEO
Project description:Friedreich ataxia (FRDA) is a recessive neurodegenerative disease characterized by progressive ataxia, dyscoordination, and loss of vision. The variable length of the pathogenic GAA triplet repeat expansion in the FXN gene in part explains Inter-individual variability in severity of disease. The GAA repeat expansion leads to epigenetic silencing of FXN; therefore, variability in properties of epigenetic effector proteins could also regulate the severity of FRDA. In an exploratory analysis, DNA from 88 FRDA patients was analyzed to determine if any of 5 non-synonymous SNPs in HDACs/ SIRTs predicted FRDA disease severity. Results suggested the need for a full analysis (569 FRDA patients) at the rs352493 locus in SIRT6 (S46N SNP). Disease features were compared between patients with the common N46 SIRT6 variant and the less common S46 variant. Biochemical properties of SIRT6 were compared between S46 and N46. Linear regression of the exploratory cohort suggested a SNP (rs352493) in SIRT6 predicted neurologic severity. In follow up analysis, the genotype of SIRT6 at the locus rs352493 predicted disease features of FRDA. Patients with the S46 SIRT6 variant performed better on measures of neurological and visual function over time when compared to the more common N46 SIRT6 variant. S46 SIRT6 did not alter expression or enzymatic activity of SIRT6 or FXN however, S46 patients showed whole transcriptome differences compared to N46 patients, indicative of compensatory mechanisms against whole transcriptome changes seen in FRDA.
2022-10-04 | GSE200907 | GEO
Project description:The inherited neurodegenerative disease Friedreichâ??s ataxia (FRDA) is caused by hyperexpansion of GAAâ?¢TTC trinucleotide repeats within the first intron of the FXN gene, encoding the mitochondrial protein frataxin. Long GAAâ?¢TTC repeats causes heterochromatin-mediated silencing and loss of frataxin in affected individuals. We report the derivation of induced pluripotent stem cells (iPSCs) from FRDA patient fibroblasts through retroviral transduction of transcription factors. FXN gene repression is maintained in the iPSCs, as are the mRNA and miRNA global expression signatures reflecting the human disease. GAAâ?¢TTC repeats uniquely in FXN in the iPSCs exhibit repeat instability similar to patient families, where they expand and/or contract with discrete changes in length between generations. The mismatch repair enzyme Msh2, implicated in repeat instability in other triplet repeat diseases, is highly expressed in the iPSCs, occupies FXN intron 1, and shRNA silencing of Msh2 impedes repeat expansion, providing a possible molecular explanation for repeat expansion in FRDA. 65 samples from various number of tissue, primary cell lines undifferenatiated human embryonic stem cell lines, induces pluripotent stem cell lines have been run on Illumina HT12 v3 chips.
2010-07-30 | E-GEOD-22651 | biostudies-arrayexpress
Project description:We set out to investigate whether a histone deacetylase inhibitor (HDACi) would be effective in an in vitro model for the neurodegenerative disease Friedreich ataxia (FRDA) and to evaluate safety and surrogate markers of efficacy in a phase I clinical trial in patients. In the neuronal cell model, HDACi 109/RG2833 increases FXN mRNA levels and frataxin protein, with concomitant changes in the epigenetic state of the gene. Chromatin signatures indicate that histone H3 lysine 9 is a key residue for gene silencing through methylation and reactivation through acetylation, mediated by the HDACi. Drug treatment in FRDA patients demonstrated increased FXN mRNA and H3 lysine 9 acetylation in peripheral blood mononuclear cells. No safety issues were encountered.
2015-01-29 | GSE65399 | GEO
Project description:The inherited neurodegenerative disease Friedreich’s ataxia (FRDA) is caused by hyperexpansion of GAA•TTC trinucleotide repeats within the first intron of the FXN gene, encoding the mitochondrial protein frataxin. Long GAA•TTC repeats causes heterochromatin-mediated silencing and loss of frataxin in affected individuals. We report the derivation of induced pluripotent stem cells (iPSCs) from FRDA patient fibroblasts through retroviral transduction of transcription factors. FXN gene repression is maintained in the iPSCs, as are the mRNA and miRNA global expression signatures reflecting the human disease. GAA•TTC repeats uniquely in FXN in the iPSCs exhibit repeat instability similar to patient families, where they expand and/or contract with discrete changes in length between generations. The mismatch repair enzyme Msh2, implicated in repeat instability in other triplet repeat diseases, is highly expressed in the iPSCs, occupies FXN intron 1, and shRNA silencing of Msh2 impedes repeat expansion, providing a possible molecular explanation for repeat expansion in FRDA.
2010-07-02 | GSE22651 | GEO
Project description:Friedreich's Ataxia (FRDA), a rare, inherited, progressive degenerative disease, is caused by a defective expression of mitochondrial protein frataxin (FXN), due to homozygous hyper-expansion of GAA triplets in the gene which severely reduce its transcription. FXN is crucial for cell survival and its deficiency in humans critically affects viability of neurons, cardiomyocytes and pancreatic beta cells. Around two thirds of individuals with FRDA show typical manifestation of hypertrophic cardiomyopathy, that can progress in heart failure and death. Except for FXN, very few genes have been correlated with ataxia and cardiac disease in FRDA. To identify other genes involved in pathogenesis of FRDA, a microarray analysis on FRDA patient's lymphoblastoid cells stably reconstituted with FXN was performed. HS-1 associated protein X-1 (HAX-1), a family of proteins playing important roles in the protection of cardiomyocytes from apoptosis, is the highest up-regulated transcript (FC=+2, p<0.0006). HAX-1 is highly expressed in heart and HAX-1 heterozygous-deficient hearts exhibit increases in infarct size. The microarray result was further assessed with qRT-PCR and western blot analysis performed on HEK293 stably transfected with empty vector or FXN-vector and lymphoblasts from FRDA patients compared to clinically unaffected heterozygous parents, confirming a strong co-expression of HAX-1 and FXN both at mRNA and protein level. Moreover, analysis of FXN and HAX-1 in peripheral blood mononuclear cells (PBMCs) of FRDA patients (n=13), heterozygous parents (n=6) and non-correlated healthy controls (n=13) revealed that their expressions are correlated. The positive correlation is more significant in FRDA patients showing a cardiac disease (10/13). The positive correlation between frataxin and HAX-1 expression level suggests a potential link of HAX-1 expression to pro-survival or protective cellular pathways related to frataxin. Thus, HAX-1 may be considered a specific biomarker of cardiomyopathy in FRDA and may represent a prognostic implement in these patients. Moreover, the discovery of novel genetic "risk" or "protective" factors in cardiomyopathy is crucial to improve risk stratification strategies and to identify new therapeutic targets.
2019-12-31 | GSE108200 | GEO
Project description:CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells. The 3C-Seq design and data analysis were performed according to Stadhouders et al, Nat Protoc. 2013, 8:509-524. A series of bait sequences accommodating different locus around CCAT1-L and MYC were selected. Through integrating with specific sample barcodes, bait-specific primer sets were designed to construct relevant 3C-seq libraries in CCAT1-L knockdown and scramble knockdown (Scr) HT29 samples. All of the 3C sample libraries from different treatment, including CCAT1-L knockdown and scramble knockdown (Scr), were then pooled together for high-throughput sequencing. Two technical 3C-seq were performed (CCAT1_myc_3C_1.txt.gz and CCAT1_myc_3C_2.txt.gz) and then combined together to get enough reads for further analysis. 3C-seq reads from different samples were divided according to sample barcodes (CCAT1-L knockdown: ATGTCA; Scr: GCCAAT) and different bait sequences, and then mapped to human reference genome to assess chromatin interaction strength between CCAT1-L and MYC locus in different treatments. In our study, one representative bait-specific sequencing data (CTTCTACTGATTGGCCCTAAACACTTTTCCAAAGCTT) was select to generate bedgraph files and upload to UCSC for visualization to show the chromatin interaction between CCAT1-L and Myc locus in CCAT1-L knockdown (CCAT1-L_knockdown_out.bedgraph) and scramble knockdown (Scr_out.bedgraph) samples.
2014-02-22 | E-GEOD-55261 | biostudies-arrayexpress
Project description:Salmonella sp. 3C strain:3C Genome sequencing
| PRJNA882226 | ENA