Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Characterization of stress-responsive lncRNAs in Arabidopsis thaliana

ABSTRACT: We sequenced the total RNA from a tissues mixed sample (inflorescences, rosette leaves, cauline leaves and stems) of Arabidopsis thaliana. After total RNA extraction, the same amount of tissue RNA were mixed. Ribosomal RNAs were deleted from the mixed tissue total RNAs using RiboMinus™ Plant Kit repeated three times. We also sequenced 9 poly(A)- RNAs from seedlings treated with different stress conditions at different times. The poly(A)- RNAs were collected by removing poly(A)+ RNAs four times . Then rRNAs were removed from poly(A)- RNAs three times.

ORGANISM(S): Arabidopsis thaliana

PROVIDER: GSE49325 | GEO | 2014/09/18

SECONDARY ACCESSION(S): PRJNA213635

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Characterization of stress-responsive lncRNAs in Arabidopsis thaliana

Project description:We sequenced the total RNA from a tissues mixed sample (inflorescences, rosette leaves, cauline leaves and stems) of Arabidopsis thaliana. After total RNA extraction, the same amount of tissue RNA were mixed. Ribosomal RNAs were deleted from the mixed tissue total RNAs using RiboMinus™ Plant Kit repeated three times. We also sequenced 9 poly(A)- RNAs from seedlings treated with different stress conditions at different times. The poly(A)- RNAs were collected by removing poly(A)+ RNAs four times . Then rRNAs were removed from poly(A)- RNAs three times. Sequencing of total RNAs from the mixed tissues sample is taken as an example of collecting novel transcripts from high-throughput data, which could be clarified by noncoding scores derived from our integrative models. Sequencing of nonpolyA RNAs are used for identifing stress-responsive nonpolyA lncRNAs and for validation of predicted lncRNAs.

2014-09-18 | E-GEOD-49325 | biostudies-arrayexpress

Systematic characterization of novel lncRNAs responding to phosphate starvation in Arabidopsis thaliana

Project description:We sequenced the poly(A)+ and poly(A)- samples of the roots and shoots from 10-day-old WT seedlings grown under P+ and P- condition. The WT plant refers to Columbia ecotype Arabidopsis seedlings. Each condition has two replicates. After total RNA extraction, ribosomal RNAs were removed using RiboMinus™ Plant Kit repeated two times. The poly(A)+ and poly(A)- constituent were separated with oligo(dT) magnetic beads (Oligotex mRNA Mini Kit, QIAGEN). Using a 2-fold change and a P-value <0.05 as the cut-off for selecting the differentially expressed transcripts, we globally identified novel noncoding lncRNAs.

2016-08-31 | GSE76577 | GEO

Roles and Programming of Arabidopsis ARGONAUTE Proteins During Turnip Mosaic Virus Infection

Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.

2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress

Arabidopsis microRNA Organ Map

Project description:This experiment was designed to determine the presence and levels of microRNAs and other select small RNAs in the major organs of wild-type (Col-0) Arabidopsis thaliana grown under standard conditions. <br><br><br><br>To obtain a global overview of miRNA levels in wild-type Arabidopsis, a tissue expression map was generated. Two samples of total RNA from siliques, stems, cauline leaves, roots, short-day seedlings, long-day seedlings, and rosette leaves as well as four samples from inflorescences were obtained. All duplicate samples were harvested from independent crops of plants grown under the same conditions, and thus represent biologcial replicates. Hybridizations were always comparing a given sample against a common, synthetic reference set. 225 reference DNA oligos comprising the sense strand of each RNA represented on the array flanked by constant 5' and 3' sequences representing the adapters used in RNA cloning (Axtell and Bartel). Amplification and Cy5 end-labeling of this synthetic set of oligos provides a constant reference signal that allows comparison of different Cy3-labeled biological samples.

2005-05-01 | E-MEXP-292 | biostudies-arrayexpress

RNA-seq of Malassezia sympodialis

Project description:This data set is part of a study where the genome of Malassezia sympodialis (strain ATCC 42132) was sequenced using long-read technology and annotated using RNA-seq and proteogenomics. RNA was extracted at two different culture times (2 and 4 days). Seven RNA-seq libraries were prepared from independent samples. Two samples (P2 and P3) were enriched for protein-coding RNA using poly(A)-selection. The remaining five samples were processed with RiboMinus to deplete ribosomal RNA, and thus retain both mRNA and non-ribosomal noncoding RNA for sequencing. In total, we obtained 71 million RNA-seq read pairs mapping to genomic regions other than the highly expressed ribosomal loci.

2017-01-10 | E-MTAB-4589 | biostudies-arrayexpress

Expression Profiling of Arabidopsis Long Intergenic Nongcoding RNA in Inflorescences, Leaves, and Roots

Project description:Long intergenic noncoding RNAs (lincRNA) transcribed from intergenic regions of eukaryotic genomes play important roles in key biological processes; yet, plant lincRNAs remain poorly characterized. Here we profiled lincRNA expression in inflorescences, leaves and roots using ATH lincRNA v1 array. we found 92% lincRNAs could be detected in at least 2 ATH lincRNA v1 arrays and majority of the lincRNAs were expressed at levels higher than those of pri-miRNAs but lower than those of mRNAs.Using a cut-off of 2-fold change, we identified 149 lincRNAs preferentially expressed in inflorescences, 232 in leaves and 164 in roots. Nine arrays were hybridized with RNAs from inflorescences, leaves and roots with 3 biological replicates.

2011-08-05 | E-GEOD-30394 | biostudies-arrayexpress

Expression Profiling of Arabidopsis Long Intergenic Nongcoding RNA in Inflorescences, Leaves, and Roots

2011-08-06 | GSE30394 | GEO

Genome-wide identiﬁcation of circular RNAs in Arabidopsis thaliana

Project description:To exlore more circRNAs involved in Arabidopsis thaliana, we deeply sequenced 14 samples including whole plants from four developmental stages (rosette leaves > 1 mm in length; rosette growth complete; 50% of flowers to be produced have opened; first silique shattered), aerial part of plants from four stress treatments (control, drought, salinity and heat), five organs (roots, stems, leaves, flowers and siliques) and a mixed sample from whole plants across the lifespan (cotyledons emergence, rosette leaves﹥1 mm, rosette growth complete, first flower open, flourishing florescence, first silique shattered, senescence). The total RNA was purified by rRNA-depletion and linear RNA removal with RNAseR, and paired-end (PE) sequenced by Illumina HiSeq 2500 (read length, PE125, the mixed sample) and Illumina Hiseq X Ten (read length, PE150, 13 independent samples) platforms. We obtained 181.97 Gb raw data (151.37 Gb from 13 samples and 30.6 Gb from a mixed sample) and identified 5861 circRNAs with expression quantity. We annotated the parent genes of these circRNAs and predicted their target sites of microRNAs.

2016-09-01 | GSE77672 | GEO

High-throughput sequencing of small RNAs in Vitis vinifera

Project description:Vitis vinifera endogenous small RNAs Size fractionated small RNA from total RNA extracts of Vitis vinifera leaves, inflorescences, tendrils and small berries were ligated to adapters, purified again and reverse transcribed. After PCR amplification the sample was subjected to Solexa/Illumina high throughput pyrosequencing. Please see www.illumina.com for details of the sequencing technology.

2010-04-29 | E-GEOD-18405 | biostudies-arrayexpress

WT HeLa total RNA-seq (RiboMinus)

Project description:WT HeLa total RNA-seq (RiboMinus)

| PRJNA454025 | ENA