Identification of genes differentially expressed in MZeomesa embryos compared with wild-type
Ontology highlight
ABSTRACT:
ORGANISM(S): Danio rerio
PROVIDER: GSE51893 | GEO | 2014/10/15
SECONDARY ACCESSION(S): PRJNA225691
REPOSITORIES: GEO
Similar Datasets
Project description:Study of Smad2 and Eomesa genomic binding in zebrafish blastulas, their relationship to eachother and the relaptionship between genomic binding and Ndr1 and Eomesa responsive genes as identified by microarray and RNA-seq. Replicate RNA samples from wild-type and MZeomesa sphere stage embryos
2014-10-15 | E-GEOD-51893 | biostudies-arrayexpress
Project description:Study of Smad2 and Eomesa genomic binding in zebrafish blastulas, their relationship to eachother and the relaptionship between genomic binding and Ndr1 and Eomesa responsive genes as identified by microarray and RNA-seq.
2014-10-15 | GSE51891 | GEO
Project description:Study of Smad2 and Eomesa genomic binding in zebrafish blastulas, their relationship to eachother and the relaptionship between genomic binding and Ndr1 and Eomesa responsive genes as identified by microarray and RNA-seq. Replicate ChIP samples with associated input for Smad2 and Eomesa - 4x ChIP samples (2 per factor); 2x input samples
2014-10-15 | E-GEOD-51891 | biostudies-arrayexpress
Project description:Identification of genes downstream of ndr1 in zebrafish blastulas, and identification of direct targets by reference with Smad2 and Eomesa ChIP-seq data
2014-10-15 | GSE51890 | GEO
Project description:Identification of genes downstream of ndr1 in zebrafish blastulas, and identification of direct targets by reference with Smad2 and Eomesa ChIP-seq data Triplicate control injected samples and triplicate samples of embryos injected with 50pg ndr1 mRNA per embryo. Total RNA prepared from ~200 sphere stage embryos per sample.
2014-10-15 | E-GEOD-51890 | biostudies-arrayexpress
Project description:The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.
2007-07-30 | GSE8076 | GEO
Project description:Here, using ChIP-Seq, we examined the targets of Nanog-like and Mxtx2 in blastula stage zebrafish embryos. We found that Nanog-like bind to its known targets like Oct4, Sox2, and Nanog-like. Nanog-like also bound to genes involved in extraembryonic lineage differentiation, like gata3 and krt4 for EVL differentiation, and mxtx2 and slc26a1 for YSL differentiation, mesoderm specification like ntl and tbx3, cell movement like wnt11 and cxcr4b, and signaling genes like ndr1, bmp2b, fgf8a and wnt8a. The binding profile suggests that Nanog-like may play a versatile role involving many developmental processes. We found 11.3% of the genes (1751 out of all annotated 15500 zebrafish genes) and 43.6% of the YSL genes (118 out of 271 genes expressed in the YSL) were bound by Mxtx2, suggesting Mxtx2 bound directly to YSL genes to activate their expression Examination of Nanog-like and Mxtx2 binding sites in 3.5hpf and 4.5hpf zebrafish embryos
2011-12-28 | E-GEOD-34683 | biostudies-arrayexpress
Project description:Differentially expressed microRNAs were detected to explore the molecular mechanisms of diapause termination. The total small RNA of diapause-destined silkworm eggs and HCl-treated eggs was extracted and then sequenced using HiSeq high-throughput method. 44 novel miRNAs were discovered. Compared to those in the diapause-destined eggs, 61 miRNAs showed significant changes in the acid-treated eggs, with 23 being up-regulated and 38 being down-regulated. The potential target genes of differentially expressed miRNAs were predicted by miRanda. Gene Ontology and KEGG pathway enrichment analysis of these potential target genes revealed that they were mainly located within cells and organelles, involved in cellular and metabolic processes, and participated in protein production, processing and transportation. Two differentially expressed genes, Bombyx mori SDH and Bmo-miR-2761-3p, were further analyzed with qRT-PCR. BmSDH was significantly up-regulated in the HCl-treated eggs, while Bmo-miR-2761-3p was down-regulated. These results suggested that these two genes were well coordinated in silkworm eggs. Dual luciferase reporter assay demonstrated that Bmo-miR-2761-3p inhibited the expression of BmSDH.
| S-EPMC5507411 | biostudies-literature
Project description:Here, using ChIP-Seq, we examined the targets of Nanog-like and Mxtx2 in blastula stage zebrafish embryos. We found that Nanog-like bind to its known targets like Oct4, Sox2, and Nanog-like. Nanog-like also bound to genes involved in extraembryonic lineage differentiation, like gata3 and krt4 for EVL differentiation, and mxtx2 and slc26a1 for YSL differentiation, mesoderm specification like ntl and tbx3, cell movement like wnt11 and cxcr4b, and signaling genes like ndr1, bmp2b, fgf8a and wnt8a. The binding profile suggests that Nanog-like may play a versatile role involving many developmental processes. We found 11.3% of the genes (1751 out of all annotated 15500 zebrafish genes) and 43.6% of the YSL genes (118 out of 271 genes expressed in the YSL) were bound by Mxtx2, suggesting Mxtx2 bound directly to YSL genes to activate their expression
2011-12-28 | GSE34683 | GEO
Project description:Purpose: This study aimed to identify differentially expressed genes and transcripts in zebrafish embryos and larvae following benzo[a]pyrene (BaP) exposure. Methods: Adult zebrafish (2 males × 4 females, N=6 replicate tanks for each treatment) were acclimated for 7 days in an 818 Low Temp Illuminated Incubator (Precision Scientific, Chennai, India) at 28.5°C. Next, adult fish were waterborne exposed to control or 50 μg/L (ppb) BaP for 7 days; ethanol was used as vehicle solvent, and final ethanol concentration was 0.1 mL/L (100 ppm) in all treatment groups. This dose of ethanol is not teratogenic to zebrafish. Water was changed and/or re-dosed daily. From day 7 to 11 of the parental exposure, eggs were collected, counted, and raised in normal conditions (control) or continuously exposed to 50 μg/L BaP until 3.3 and 96 hours post fertilization (hpf). At 3.3 or 96 hpf, embryos (200/pool) or larvae (10/pool) were collected and pooled. Total RNA was isolated for transcriptomic RNA sequencing with Illumina HiSeq2000 (2X100bp). RNA-seq reads were uploaded to the galaxy platform https://main.g2.bx.psu.edu/. RNA-seq reads were trimmed, filtered, and aligned to the zebrafish genome (Danio_rerio.Zv9.68) with the Tophat for Illumina tool. Counting and annotation of RNA-seq reads were performed with Partek Genomics Suite version 6.11. Refseq Transcripts (2013-04-10) and Ensembl Transcripts release 70 databases were used for gene and transcript annotation. Differential expression of gene and transcript reads between treatments was analyzed with R package EdgeR. Genes/transcripts with false discovery rate (FDR) less than 0.05 and absolute fold change greater than 1.5 were considered as significant. Differentially expressed genes were defined as genes with altered expression at either gene or transcript level. Results: Differential expression analysis with EdgeR revealed that gene expression was vastly different between 3.3 hpf zebrafish embryos and 96 hpf larvae. Using Refseq annotation, we found that 10644 out of 13950 transcribed zebrafish genes were differentially expressed between the two developmental time-points, with 5961 up-regulated genes and 4683 down-regulated genes in 96 hpf larvae compared with 3.3 hpf embryos. Similarly, using Ensembl annotation, 16529 out of 19886 transcribed zebrafish genes were differentially expressed, with 9318 up-regulated genes and 7211 down-regulated genes in 96 hpf larvae compared with 3.3 hpf embryos. In 3.3 hpf embryos, four genes and seven transcripts were differentially expressed after BaP exposure. In 96 hpf larvae, 447 and 484 zebrafish genes were significantly up- and down-regulated, respectively, by BaP exposure. Conclusions: Parental and developmental BaP exposure caused gene expression changes in zebrafish embryos and larvae. Illumina HiSeq2000 deep sequencing was used to generate transcriptomic profiles for BaP-exposed 3.3 hpf zebrafish embryos (n=3 for control, n=3 for BaP) and 96 hpf larvae (n=2 for control, n=2 for BaP).
2015-09-04 | E-GEOD-64198 | biostudies-arrayexpress