Epstein Barr Virus Nuclear Antigen 3C binds to BATF/IRF4/SPI1 sites and represses CDKN2A by recruiting Sin3A
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE52632 | GEO | 2013/12/22
SECONDARY ACCESSION(S): PRJNA229507
REPOSITORIES: GEO
Similar Datasets
Project description:We report the application of ChIP Seq to study the Epstein Barr Virus Nuclear Antigen 3C, an essential transcriptional regulator involved in the transformation of Resting B Lymphocytes to the immortalized Lymphoblast Cell Lines Examination of viral and cellular transcription factors in 1 type of cell line
2013-12-22 | E-GEOD-52632 | biostudies-arrayexpress
Project description:Epstein-Barr virus nuclear antigen 3C (EBNA3C) repression of CDKN2A p14(ARF) and p16(INK4A) is essential for immortal human B-lymphoblastoid cell line (LCL) growth. EBNA3C ChIP-sequencing identified >13,000 EBNA3C sites in LCL DNA. Most EBNA3C sites were associated with active transcription; 64% were strong H3K4me1- and H3K27ac-marked enhancers and 16% were active promoters marked by H3K4me3 and H3K9ac. Using ENCODE LCL transcription factor ChIP-sequencing data, EBNA3C sites coincided (±250 bp) with RUNX3 (64%), BATF (55%), ATF2 (51%), IRF4 (41%), MEF2A (35%), PAX5 (34%), SPI1 (29%), BCL11a (28%), SP1 (26%), TCF12 (23%), NF-?B (23%), POU2F2 (23%), and RBPJ (16%). EBNA3C sites separated into five distinct clusters: (i) Sin3A, (ii) EBNA2/RBPJ, (iii) SPI1, and (iv) strong or (v) weak BATF/IRF4. EBNA3C signals were positively affected by RUNX3, BATF/IRF4 (AICE) and SPI1/IRF4 (EICE) cooccupancy. Gene set enrichment analyses correlated EBNA3C/Sin3A promoter sites with transcription down-regulation (P < 1.6 × 10(-4)). EBNA3C signals were strongest at BATF/IRF4 and SPI1/IRF4 composite sites. EBNA3C bound strongly to the p14(ARF) promoter through SPI1/IRF4/BATF/RUNX3, establishing RBPJ-, Sin3A-, and REST-mediated repression. EBNA3C immune precipitated with Sin3A and conditional EBNA3C inactivation significantly decreased Sin3A binding at the p14(ARF) promoter (P < 0.05). These data support a model in which EBNA3C binds strongly to BATF/IRF4/SPI1/RUNX3 sites to enhance transcription and recruits RBPJ/Sin3A- and REST/NRSF-repressive complexes to repress p14(ARF) and p16(INK4A) expression.
| S-EPMC3890834 | biostudies-literature
Project description:Salmonella sp. 3C strain:3C Genome sequencing
| PRJNA882226 | ENA
Project description:Scytalidium sp. 3C strain:3C Genome sequencing and assembly
| PRJNA243259 | ENA
Project description:Verrucomicrobium sp. 3C strain:3C Genome sequencing and assembly
| PRJNA165235 | ENA
Project description:Interferon regulatory factor 4 (IRF4) is an IRF family transcription factor with critical roles in lymphoid development and in regulating the immune response. IRF4 binds DNA weakly owing to a carboxy-terminal auto-inhibitory domain, but cooperative binding with factors such as PU.1 or SPIB in B cells increases binding affinity, allowing IRF4 to regulate genes containing ETS-IRF composite elements (EICEs; 5'-GGAAnnGAAA-3'). Here we show that in mouse CD4(+) T cells, where PU.1/SPIB expression is low, and in B cells, where PU.1 is well expressed, IRF4 unexpectedly can cooperate with activator protein-1 (AP1) complexes to bind to AP1-IRF4 composite (5'-TGAnTCA/GAAA-3') motifs that we denote as AP1-IRF composite elements (AICEs). Moreover, BATF-JUN family protein complexes cooperate with IRF4 in binding to AICEs in pre-activated CD4(+) T cells stimulated with IL-21 and in T(H)17 differentiated cells. Importantly, BATF binding was diminished in Irf4(-/-) T cells and IRF4 binding was diminished in Batf(-/-) T cells, consistent with functional cooperation between these factors. Moreover, we show that AP1 and IRF complexes cooperatively promote transcription of the Il10 gene, which is expressed in T(H)17 cells and potently regulated by IL-21. These findings reveal that IRF4 can signal via complexes containing ETS or AP1 motifs depending on the cellular context, thus indicating new approaches for modulating IRF4-dependent transcription.
| S-EPMC3537508 | biostudies-literature
Project description:Gordonibacter pamelaeae 3C RNA sequencing
| PRJNA557714 | ENA
Project description:Flavobacteria bacterium MS024-3C overview
| PRJNA36813 | ENA
Project description:CCAT1-L is a highly expressed long noncoding RNA located in the colorectal cancer specific super enhance region about 500 kb upstream of MYC gene. Knockdown of CCAT1-L significantly down-regulated interaction frequency between CCAT1 and MYC locus and repress MYC expression, suggesting a long-range chromatin interaction between CCAT1-L and MYC locus maintained by CCAT1-L underlie the MYC regulation. To further validate this hypothesis, multiplexed 3C sequencing (3C-seq) was employed to evaluate chromatin interaction strength between CCAT1-L and MYC locus in CCAT1-L knockdown and scramble knockdown (Scr) HT29 cells. The 3C-Seq design and data analysis were performed according to Stadhouders et al, Nat Protoc. 2013, 8:509-524. A series of bait sequences accommodating different locus around CCAT1-L and MYC were selected. Through integrating with specific sample barcodes, bait-specific primer sets were designed to construct relevant 3C-seq libraries in CCAT1-L knockdown and scramble knockdown (Scr) HT29 samples. All of the 3C sample libraries from different treatment, including CCAT1-L knockdown and scramble knockdown (Scr), were then pooled together for high-throughput sequencing. Two technical 3C-seq were performed (CCAT1_myc_3C_1.txt.gz and CCAT1_myc_3C_2.txt.gz) and then combined together to get enough reads for further analysis. 3C-seq reads from different samples were divided according to sample barcodes (CCAT1-L knockdown: ATGTCA; Scr: GCCAAT) and different bait sequences, and then mapped to human reference genome to assess chromatin interaction strength between CCAT1-L and MYC locus in different treatments. In our study, one representative bait-specific sequencing data (CTTCTACTGATTGGCCCTAAACACTTTTCCAAAGCTT) was select to generate bedgraph files and upload to UCSC for visualization to show the chromatin interaction between CCAT1-L and Myc locus in CCAT1-L knockdown (CCAT1-L_knockdown_out.bedgraph) and scramble knockdown (Scr_out.bedgraph) samples.
2014-02-22 | E-GEOD-55261 | biostudies-arrayexpress
Project description:Epstein Barr virus (EBV) nuclear antigen 3C (EBNA3C) is an essential transcription factor for initiating and maintaining human B lymphocyte transformation to lymphoblastoid cell lines (LCLs). To comprehensively identify EBNA3C regulated cell genes in LCLs, oligonucleotide arrays were used to compare RNA abundances in 3 different LCLs transformed by an EBV that conditionally expresses EBNA3C. Cell RNA levels were assessed in actively growing LCLs, under non-permissive or permissive conditions or under non-permissive conditions after transcomplementation with wild type EBNA3C. A two-way ANOVA model with covariates including the 3 different clone effects and the 3 EBNA3C expression levels, identified 550 EBNA3C regulated genes, with False Discovery Rate <0.01 and >1.5 fold change. A seeded Bayesian network analysis of the 80 most significantly EBNA3C regulated genes that changed >1.5 fold, positioned RAC1, LYN and TNF upstream of other EBNA3C regulated genes. Further, Gene Set Enrichment Assay (GSEA) identified EBNA3C regulated genes to be enriched for MAP kinase signaling, cytokine-cytokine receptor interactions, JAK-STAT signaling, and cell adhesion molecule effects, implicating these pathways in LCL growth or survival. Moreover, 106 EBNA3C regulated genes could be placed in protein interaction networks. Since CXCL12 and CXCR4 signaling are implicated in LCL growth and were EBNA3C up-regulated, up-regulation of CXCL12 was validated by qRT-PCR and effects on induced LCL migration were confirmed. EBNA3C regulated genes significantly overlapped with EBNA2 and EBNA3A regulated genes, consistent with a central role for RBP/CSL in these effects.
2011-01-06 | GSE24362 | GEO