Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Genome-wide view of TGFb/Foxh1 regulation of the early mesendoderm program [ChIP-seq]

ABSTRACT: We defined the genome-wide binding regions of Smad2/3 and Foxh1 at mid-gastrula stage Xenopus tropicalis embryos, at which Nodal signaling and Foxh1 are critical in mesendoderm specification program.

ORGANISM(S): Xenopus tropicalis

PROVIDER: GSE53652 | GEO | 2014/11/07

SECONDARY ACCESSION(S): PRJNA232589

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

HEB and E2A function as SMAD/FOXH1 cofactors

Project description:Nodal signaling, mediated through SMAD transcription factors, is necessary for pluripotency maintenance and endoderm commitment. We have identified a new motif, termed SMAD Complex Associated (SCA) that is bound by SMAD2/3/4 and FOXH1 in human embryonic stem cells (hESCs) and derived endoderm. We demonstrate that two bHLH proteins - HEB and E2A - bind the SCA motif at regions overlapping SMAD2/3 and FOXH1. Further, we show that HEB and E2A associate with SMAD2/3 and FOXH1, suggesting they form a complex at critical target regions. This association is biologically important, as E2A is critical for mesendoderm specification, gastrulation, and Nodal signal transduction in Xenopus tropicalis embryos. Taken together, E2A is a novel Nodal signaling cofactor that associates with SMAD2/3 and FOXH1 and is necessary for mesendoderm differentiation. ChIP-seq of Smad2/3 and Input in X.tropicalis, stage 10.5 embryo.

2011-08-23 | E-GEOD-30146 | biostudies-arrayexpress

HEB and E2A function as SMAD/FOXH1 cofactors

2011-08-23 | GSE30146 | GEO

Genome-wide view of TGFb/Foxh1 regulation of the early mesendoderm program [RNA-seq]

Project description:We identified Nodal and Foxh1 downstream targets by performing RNA-seq of embryos either treated with small molecule SB431542 or microinjected morpholino anti-sense oligo against Foxh1.

2014-11-07 | GSE53653 | GEO

Foxh1 marks the embryonic genome prior to the activation of the mesendoderm gene regulatory program

Project description:We examined the binding dynamics of the maternal TF Foxh1 over a time course of germ layer development. Foxh1 binding was compared to the onset of zygotic transcription (RNA pol II), binding of the co-repressor Tle, Nodal signaling (Smad2/3) and the zygotic endoderm TF Foxa.

2017-03-30 | GSE85273 | GEO

Genome-wide analysis of Smad2 and FoxH1 binding sites in zebrafish blastula

Project description:Morphogen gradients expose cells to different signal concentrations and induce target genes with different ranges of expression. To determine how the Nodal morphogen gradient induces distinct gene expression patterns during zebrafish embryogenesis we characterized the binding sites of the Nodal-specific transcription co-activators Smad2 and FoxH1 in wild-type, Nodal-overexpressing or Nodal signaling inhibited embryos. We found that FoxH1 binds to Nodal targets loci even in the absence of the signal, while Smad2 only binds and colocalizes to FoxH1 upon induction of the Nodal pathway.

2015-04-08 | GSE67648 | GEO

Identification of differentially-expressed genes between FoxH1 morpholino and control in zebrafish embryos.

Project description:The Forkhead Box H1 (FoxH1) protein is a co-transcription factor recruited by phosphorylated Smad2 downstream of several TGFbetas, including Nodal-related proteins. We have reassessed the function of zebrafish FoxH1 using antisense morpholino oligonucleotides (MOs) ( 5’ TGCTTTGTCATGCTGATGTAGTGGG 3’) as compared with a control morpholino (MO) with no specific target (5’ TAGTTAAGCCTAGCTCTCATAAACT 3’). Probing FoxH1 morphant RNA by microarray, we identified a cohort of five keratin genes – cyt1, cyt2, krt4, krt8 and krt18 - that are normally transcribed in the embryo’s enveloping layer (EVL) and which have significantly reduced expression in FoxH1-depleted embryos. Keywords: 40% epiboly-stage embryos, injected with either 8 ng of a 25mer morpholino (MO) with no specific target or 8 ng of a 25mer MO with reverse complementary to the 5’ untranslated region of the zebrafish foxH1 gene.

2007-07-30 | GSE8076 | GEO

RNAseq & Smad and Foxh1 ChIpseq in pluripotent mESC and EBs

Project description:Smad2, Smad3, Smad4 and Foxh1 ChIPseq performed in pluripotent mESC and embryonic bodies (EBs). RNAseq were performed in WT mESCs and Ebs of WT, Smad2KO, Smad3KO and Smad2/3DKO.

2019-09-05 | GSE125116 | GEO

Genome-wide view of TGFb/Foxh1 regulation of the early mesendoderm program

Project description:This SuperSeries is composed of the SubSeries listed below.

2014-11-07 | GSE53654 | GEO

Activin/Smad2 and Wnt/β-catenin upregulate HAS2 and ALDH3A2 to facilitate mesendoderm differentiation of human ESCs

Project description:Activin and Wnt signaling are necessary and sufficient for mesendoderm (ME) differentiation of human embryonic stem cells (hESCs). In this study, we report that during the Activin and Wnt induced ME differentiation, Activin/Smad2 induces decrease of the repressive histone modification H3K27me3 by promoting proteasome-dependent degradation of EZH2. As a result, recruitment of the forkhead protein FOXH1 on open chromatin regions integrates the signals of Activin/Smad2 and Wnt/β-catenin to activate the expression of the ME genes including HAS2 and ALDH3A2. Knockdown of HAS2 and ALDH3A2 greatly attenuates ME differentiation. These findings unveil a pathway from extracellular signals to epigenetic modification-mediated gene activation during ME commitment.

2018-09-29 | GSE113047 | GEO

Foxh1/nodal defines context-specific direct maternal Wnt/Beta-catenin target gene regulation in early development

Project description:This study aimed to further understand context-specific direct Wnt target gene expression through the use of beta-catenin and FoxH1 ChIP Sequencing data at various developmental stages representing both maternal and zygotic Wnt signalling. Results were further supported through the use of RNA sequencing data from beta-catenin, FoxH1 and nodal gene knock down assays.

2020-06-21 | E-MTAB-8555 | biostudies-arrayexpress

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data