Shld1 effect on 3T3 cell
Ontology highlight
ABSTRACT:
ORGANISM(S): Mus musculus
PROVIDER: GSE5916 | GEO | 2007/09/27
SECONDARY ACCESSION(S): PRJNA97359
REPOSITORIES: GEO
Similar Datasets
Project description:NIH3T3 cells were cultured in medium containing 1 uM, 100 nM, 10 nM and 0 nM (serve as control) shld1 for 24 hours. Three independent cultures were obtained for each drug concentration. Total RNA from experimental samples were extracted using RNeasy Kit (Qiagen). Mouse RNA pooled from 11 cell lines (Stratagene, La Jolla, CA) was used as reference. Cy5-dUTP and Cy3-dUTP, were used to label the experimental cDNA and the reference samples, respectively, and hybridized to the Mouse Exonic Evidence Based Oligonucleotide (MEEBO) arrays (http://www.microarray.org./sfgf/meebo). The hybridizations were performed by Stanford Functional Genome Facility using its standard protocol (Oligo Array Hybridization protocol, http://www.microarray.org./sfgf/docView.do?type=2). A compound treatment design type is where the response to administration of a compound or chemical (including biological compounds such as hormones) is assayed. Computed
2007-09-27 | E-GEOD-5916 | biostudies-arrayexpress
Project description:Total RNA was extracted from skin biopsies before and after imatinib (Gleevec) treatment using Qiagen RNeasy fibrous tissue kit. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. Amplified skin RNA (labeled with Cy5) and amplified Stratagene Human Universal Reference RNA (labeled with Cy3) were competitively hybridized to HEEBO microarrays in duplicate as described (http://www.microarray.org/sfgf/heebo.do). 161a/b: Patient 1, pre-Gleevec treatment 170a/b: Patient 1, post-Gleevec treatment 215a/b: Patient 2, pre-Gleevec treatment 232a/b: Patient 2, post-Gleevec treatment A compound treatment design type is where the response to administration of a compound or chemical (including biological compounds such as hormones) is assayed. Compound Based Treatment: Treated with 100 mg Gleevec twice daily for 3 months or 200 mg Gleevec daily for 6 months Keywords: compound_treatment_design
2009-03-31 | GSE11130 | GEO
Project description:Total RNA was extracted from skin biopsies before and after imatinib (Gleevec) treatment using Qiagen RNeasy fibrous tissue kit. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. Amplified skin RNA (labeled with Cy5) and amplified Stratagene Human Universal Reference RNA (labeled with Cy3) were competitively hybridized to HEEBO microarrays in duplicate as described (http://www.microarray.org/sfgf/heebo.do). 161a/b: Patient 1, pre-Gleevec treatment 170a/b: Patient 1, post-Gleevec treatment 215a/b: Patient 2, pre-Gleevec treatment 232a/b: Patient 2, post-Gleevec treatment A compound treatment design type is where the response to administration of a compound or chemical (including biological compounds such as hormones) is assayed. Compound Based Treatment: Treated with 100 mg Gleevec twice daily for 3 months or 200 mg Gleevec daily for 6 months Keywords: compound_treatment_design Computed
2009-03-31 | E-GEOD-11130 | biostudies-arrayexpress
Project description:Amplification of 20q13 occurs in 20-30% of primary human breast cancers and correlates with poor prognosis. The transcription factor ZNF217 is a candidate oncogene in 20q13. Patients with breast tumors expressing high ZNF217 had reduced survival and increased resistance to chemotherapy. Inducible Znf217 expression in the mammary epithelium of our transgenic mouse resulted in premalignant and invasive lesions. Znf217 overexpression in a mouse luminal breast cancer model generated primary tumors with heterogeneous epithelial and progenitor cell marker expression and promoted metastasis. The AKT inhibitor triciribine inhibited growth and restored sensitivity to a cytotoxic drug in cells expressing high ZNF217. Triciribine reduced tumor burden in vivo, suggesting that ZNF217 may be a novel drug target. Total RNA was isolated from samples overexpressing ZNF217 (4 NMuMG). RNA was also harvested from each cell line expressing a vector control to use as a reference for each microarray sample analyzed. Total RNA was hybridized to mouse MEEBO arrays as described (http://www.microarray.org/sfgf/meebo.do). Samples were verified to have strong overexpression of ZNF217 by qRT-PCR or Western analysis.
2015-05-18 | E-GEOD-38047 | biostudies-arrayexpress
Project description:The transcription factor ZNF217 is a candidate oncogene in the amplicon on chromosome 20q13 that occurs in 20-30% of primary human breast cancers and that correlates with poor prognosis. We show Znf217 overexpression drives aberrant differentiation and signaling events, promotes increased self-renewal capacity, mesenchymal marker expression, motility and metastasis, and represses an adult tissue stem cell gene signature downregulated in cancers. By in silico screening, we identified candidate therapeutics that at low concentrations inhibit growth of cancer cells expressing high ZNF217. We demonstrate that the nucleoside analog triciribine inhibits ZNF217-induced tumor growth and chemotherapy resistance, and inhibits signaling events (e.g., P-AKT, P-MAPK) in vivo. Our data suggest ZNF217 is a biomarker of poor prognosis and a therapeutic target in breast cancer patients, and triciribine may be part of a personalized treatment strategy in patients overexpressing ZNF217. Since ZNF217 is amplified in numerous cancers, these results have implications for other cancers. Total RNA was isolated from samples overexpressing ZNF217 (3 Primary and 5 SCp2). RNA was also harvested from each cell line expressing a vector control to use as a reference for each microarray sample analyzed. Total RNA was hybridized to mouse MEEBO arrays as described (http://www.microarray.org/sfgf/meebo.do). Samples were verified to have strong overexpression of ZNF217 by qRT-PCR or Western analysis.
2012-05-17 | E-GEOD-24727 | biostudies-arrayexpress
Project description:To study the bromodomain protein PfBDP1 in the malaria parasite P. falciparum, a transgenic parasite line was generated (PfBDP1DD) in which PfBDP1 was tagged with a haemagglutinin tag and a ligand regulatable FKBP destabilization domain that allowed conditional knockdown of PfBDP1 by removal of the stabilizing ligand Shld1 from cultures. Shld1 was removed 30 hours post invasion (hpi) and the cells allowed to reinvade fresh red blood cells. The effects of PfBDP1 knockdown on gene expression were assessed by transcriptional profiling on microarrays over 6 consecutive time points (8 hour intervals) in the intraerythrocytic developmental cycle (IDC). Two condition matched time course experiment, PfBDP1DD ON versus OFF Shld1. Transgenic P. falciparum 3D7 parasites (PfBDP1DD) expressing an endogeneous PfBDP1-HA-DD fusion protein were grown in the presence of 2.5 nM WR99210/500 nM Shld1 (PfBDP1DD_ON) or 2.5 nM WR99210 (PfBDP1DD_OFF). After invasion, RNA was extracted at 6 consectutive time points in 8 hour intervals during the IDC, starting at 4 hpi, and was processed for microarray analysis. Three matched biological replicates were performed for both conditions, independently grown and harvested. Each array represents one RNA sample.
2015-01-07 | E-GEOD-64688 | biostudies-arrayexpress
Project description:We completed genome-wide microarray analysis in Sirt6 knockout (ko) mouse embryonic fibroblasts (MEFs) and control wildtype (wt) MEFs. Prior to RNA extraction, MEFs were treated with TNF-alpha (10 ng/ml) for the indicated times. Total RNA was extracted with TRIzol (Invitrogen) and amplified with Ambion Amino Allyl MessageAmp II Amplification kit. Amplified mouse Universal Reference RNA (Stratagene) was used as reference RNA for analysis. Array hybridization of mouse MEEBO arrays is as described (Hendrickson et al., PLoS ONE, 2008). Groups of assays that are related as part of a time series. Compound Based Treatment: 10 ng/ml TNF-alpha Keywords: time_series_design
2009-01-09 | GSE13207 | GEO
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do).
2012-08-23 | GSE39572 | GEO
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do). genetic_modification_design
2012-08-23 | E-GEOD-39572 | biostudies-arrayexpress
Project description:We completed genome-wide microarray analysis in Sirt6 knockout (ko) mouse embryonic fibroblasts (MEFs) and control wildtype (wt) MEFs. Prior to RNA extraction, MEFs were treated with TNF-alpha (10 ng/ml) for the indicated times. Total RNA was extracted with TRIzol (Invitrogen) and amplified with Ambion Amino Allyl MessageAmp II Amplification kit. Amplified mouse Universal Reference RNA (Stratagene) was used as reference RNA for analysis. Array hybridization of mouse MEEBO arrays is as described (Hendrickson et al., PLoS ONE, 2008). Groups of assays that are related as part of a time series. Compound Based Treatment: 10 ng/ml TNF-alpha Keywords: time_series_design Computed
2010-06-24 | E-GEOD-13207 | biostudies-arrayexpress