Pol-IV dependent transcripts in Arabidopsis
Ontology highlight
ABSTRACT:
ORGANISM(S): Arabidopsis thaliana
PROVIDER: GSE61439 | GEO | 2015/09/13
SECONDARY ACCESSION(S): PRJNA261075
REPOSITORIES: GEO
Similar Datasets
Project description:small RNA, PATH and mRNA libraries were made to characterize Col and various small RNA biogenesis mutants. Genome-wide RNA profiling was done by Illumina TruSeq sample preparation kits followed by high-throughput sequencing with Illumina HiSeq 2500 platform.
2015-09-13 | E-GEOD-61439 | biostudies-arrayexpress
Project description:24 nucleotide siRNAs are central players in RNA-directed DNA methylation (RdDM), a process that establishes DNA methylation at transposable elements to ensure genome stability. The plant-specific RNA polymerase IV (Pol IV) is required for siRNA biogenesis and is thought to transcribe RdDM loci to produce primary transcripts that serve as precursors to siRNAs. Yet, no such transcripts have ever been reported. Here, through RNA sequencing and double-stranded RNA sequencing in genotypes that compromise the dicing of siRNA precursors, we were able to identify Pol IV-dependent transcripts from tens of thousands of loci. We show that Pol IV-dependent transcripts correspond to both DNA strands, while the Pol II-dependent transcripts produced upon de-repression of the loci are derived from primarily one strand. We show that Pol IV-dependent transcripts have a 5â monophosphate, lack a polyA tail at the 3â end, and contain no introns; these features distinguish them from Pol II-dependent transcripts. Moreover, RDR2 is shown to play similar roles with Pol IV in both the abundance of siRNA precursors and siRNAs as well as the CHH DNA methylation. The decreased CHH methylation at dcl234 can inhibit the transcription of Pol IV at DRM2-target sites. Finally, the regulations of siRNA biogenesis were explored. To detect siRNA precursors transcribed by RNA polymerase IV, the genome wide profiling of RNA were carried out at dcl234 and dcl234 nrpd1. Different types of RNA (including Total RNA, polyA+ RNA, polyA- RNA, double stranded RNA) libraries were built to detect different transcripts. RDR2 is a RNA-dependent RNA polymerase in Pol IV complex, so the RNA-seq libraries with the mutation of RDR2 were also built. In addition, smRNA libraries with mutations blocking siRNA biogenesis were also built
2014-11-11 | E-GEOD-57215 | biostudies-arrayexpress
Project description:In plants, the biogenesis of 24 nt and 23 nt small interfering RNAs (siRNAs) requires NUCLEAR RNA POLYMERASE IV (Pol IV), RNA-DEPENDENT RNA POLYMERASE 2 (RDR2) and DICER-LIKE 3 (DCL3). We show that single-stranded M13 bacteriophage DNA can be used as a template for siRNA synthesis in vitro. Deep sequencing of RNAs produced from the in vitro reactions of Pol IV, RDR2 and DCL3 shows that Pol IV transcribes the DNA into first-strand RNAs which RDR2 then uses as templates to synthesize complementary second strands. These siRNA precursor transcripts made by Pol IV and RDR2 are mostly 30-50 nt. An untemplated 3' terminal nucleotide is a characteristic of RDR2 transcripts. DCL3 dicing of double-stranded precursor RNAs synthesized by Pol IV and RDR2 generates siRNAs that are mostly 24 nt, with a smaller population of 23 nt also produced.
2019-07-01 | GSE126086 | GEO
Project description:Multiple RNA-sequencing datasets were generated from wild-type Col-0 and hda6, pol IV or pol V null mutant samples to dissect genetic requirements for the maintenance of epigenetic memory and silent locus identity in Arabidopsis thaliana.
2014-03-27 | E-MTAB-4337 | biostudies-arrayexpress
Project description:24 nucleotide siRNAs are central players in RNA-directed DNA methylation (RdDM), a process that establishes DNA methylation at transposable elements to ensure genome stability. The plant-specific RNA polymerase IV (Pol IV) is required for siRNA biogenesis and is thought to transcribe RdDM loci to produce primary transcripts that serve as precursors to siRNAs. Yet, no such transcripts have ever been reported. Here, through RNA sequencing and double-stranded RNA sequencing in genotypes that compromise the dicing of siRNA precursors, we were able to identify Pol IV-dependent transcripts from tens of thousands of loci. We show that Pol IV-dependent transcripts correspond to both DNA strands, while the Pol II-dependent transcripts produced upon de-repression of the loci are derived from primarily one strand. We show that Pol IV-dependent transcripts have a 5’ monophosphate, lack a polyA tail at the 3’ end, and contain no introns; these features distinguish them from Pol II-dependent transcripts. Moreover, RDR2 is shown to play similar roles with Pol IV in both the abundance of siRNA precursors and siRNAs as well as the CHH DNA methylation. The decreased CHH methylation at dcl234 can inhibit the transcription of Pol IV at DRM2-target sites. Finally, the regulations of siRNA biogenesis were explored.
2014-11-11 | GSE57215 | GEO
Project description:Twenty-four-nucleotide small interfering (si)RNAs are central players in RNA-directed DNA methylation (RdDM), a process that establishes and maintains DNA methylation at transposable elements to ensure genome stability in plants. The plant-specific RNA polymerase IV (Pol IV) is required for siRNA biogenesis and is believed to transcribe RdDM loci to produce primary transcripts that are converted to double-stranded RNAs (dsRNAs) by RDR2 to serve as siRNA precursors. Yet, no such siRNA precursor transcripts have ever been reported. Here, through genome-wide profiling of RNAs in genotypes that compromise the processing of siRNA precursors, we were able to identify Pol IV/RDR2-dependent transcripts from tens of thousands of loci. We show that Pol IV/RDR2-dependent transcripts correspond to both DNA strands, whereas the RNA polymerase II (Pol II)-dependent transcripts produced upon derepression of the loci are derived primarily from one strand. We also show that Pol IV/RDR2-dependent transcripts have a 5' monophosphate, lack a poly(A) tail at the 3' end, and contain no introns; these features distinguish them from Pol II-dependent transcripts. Like Pol II-transcribed genic regions, Pol IV-transcribed regions are flanked by A/T-rich sequences depleted in nucleosomes, which highlights similarities in Pol II- and Pol IV-mediated transcription. Computational analysis of siRNA abundance from various mutants reveals differences in the regulation of siRNA biogenesis at two types of loci that undergo CHH methylation via two different DNA methyltransferases. These findings begin to reveal features of Pol IV/RDR2-mediated transcription at the heart of genome stability in plants.
| S-EPMC4315297 | biostudies-literature
Project description:Protein-protein interaction between DNA dependent RNA polymerase IV and RNA dependent RNA polymerase2. The coupled activities of the physically associated polymerases lead to the biogenesis of dsRNAs that serve as precursors of 24nt siRNAs.
2020-09-14 | PXD020170 | Pride
Project description:We were interested in identifying targets of novel putative miRNAs we identified from small RNA sequencing libraries of Arabidopsis shoots. The small RNA (smRNA) sequencing libraries were made to identify changes in abundance of specific smRNAs in response to developmental transitions in Arabidopsis thaliana shoots, with special focus on vegetative phase change. We specifically wanted to separate the temporal changes in gene expression that result from vegetative phase change and those from flowering. Because of the close timing between the juvenile-to-adult and adult-to-reproductive developmental transitions in Arabidopsis grown under long day conditions, we used the late-flowering genotype FRI;FLC developed by the lab of Richard Amasino by introgressing the FRI allele from Sf-2 into the Col-0 genetic background, which is fri;FLC. For the early flowering genotype, we used FRI;flc-3, also developed by the Amasino lab by EMS-mutagenizing FRI;FLC, identifying early flowering mutants, and backcrossing multiple times to eliminate other EMS-induced mutations. The onset of vegetative phase change in FRI;FLC and FRI;flc-3 under our growth conditions was identical, but the progression was slower in FRI;FLC. By sequencing small RNAs from shoot apices at different time points and fully-expanded leaves at different positions on the shoot and comparing the results between the two genotypes, we were able to obtain a clear picture of changes in small RNA abundance in response to vegetative phase change and flowering in Arabidopsis. We then used the remaining RNA to make genome-wide mapping of uncapped and cleaved transcripts (GMUCT) 2.0 libraries of a subset of our samples. GMUCT 2.0 allows you to identify RNAs that are 1) uncapped and in the process of 5’->3’ exonuclease degradation and 2) miRNA and siRNA-mediated cleavage products. We wanted to use these GMUCT 2.0 libraries to identify targets of novel putative miRNAs discovered by our smRNA sequencing, thereby supporting the idea that these novel putative miRNAs are in fact functional.
2016-02-01 | GSE72505 | GEO
Project description:The advent of high-throughput sequencing has led to an explosion of studies into the diversity, expression, processing, and lifespan of RNAs. Recently, three different high-throughput sequencing-based methods have been developed to specifically study RNAs that are in the process of being degraded. All three methods—genome-wide mapping of uncapped and cleaved transcripts (GMUCT), parallel analysis of RNA ends (PARE), and degradome sequencing—take advantage of the fact that Illumina sequencing libraries use T4 RNA ligase 1 to ligate an adapter to the 5’ end of RNAs that have a free 5’-monophosphate. This condition for T4 RNA ligase 1 substrates means that mature mRNAs are not substrates of the enzyme because they have a 5’-cap. As a result, these sequencing libraries are specifically made up of clones of decapped or degrading mRNAs and the 3’ fragment of cleaved miRNA and siRNA targets. In this paper, we present a massively streamlined protocol for GMUCT that takes 2-3 days and can be initiated with as little as 5 µg of starting total RNA and involves only one gel size-selection step. We show that the results are similar to libraries made using the previous GMUCT protocol and PARE. GMUCT libraries were made from flower buds of the Arabidopsis thaliana accession Columbia (Col-0) and three human cell lines—the cervical cancer cell line HeLa, human embryonic kidney 293 T (HEK293T) cell line, and the human chronic myelogenous leukaemia cell line K562—two replicates of each. Matched mRNA-seq libraries were made for each Col-0 GMUCT replicate. These libraries were sequenced on the Illumina HiSeq 2000 and the reads were trimmed to remove the adapter sequences (TGGAATTCTCGGGTGCCAAGGAACTCCAGTCA). The abundance of each unique read was determined, and unique reads were mapped to the Arabidopsis and human genomes, respectively.
2014-03-08 | E-GEOD-47121 | biostudies-arrayexpress
Project description:Gene expression in endosperm-a seed tissue that mediates transfer of maternal resources to offspring-is under complex epigenetic control. We show here that plant-specific RNA polymerase IV (Pol IV) mediates parental control of endosperm gene expression. Pol IV is required for the production of small interfering RNAs that typically direct DNA methylation. We compared small RNAs (sRNAs), DNA methylation, and mRNAs in Arabidopsis thaliana endosperm from heterozygotes produced by reciprocally crossing wild-type (WT) plants to Pol IV mutants. We find that maternally and paternally acting Pol IV induce distinct effects on endosperm. Loss of maternal or paternal Pol IV impacts sRNAs and DNA methylation at different genomic sites. Strikingly, maternally and paternally acting Pol IV have antagonistic impacts on gene expression at some loci, divergently promoting or repressing endosperm gene expression. Antagonistic parent-of-origin effects have only rarely been described and are consistent with a gene regulatory system evolving under parental conflict.
| S-EPMC9017945 | biostudies-literature