Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Tunable protein synthesis by transcript isoforms in human cells (Transcript Isoforms in Polysomes sequencing: TrIP-seq)

ABSTRACT: Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5′ and 3′ untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5′ untranslated regions exert robust translational control between cell lines, while 3′ untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels.

ORGANISM(S): Homo sapiens

PROVIDER: GSE69352 | GEO | 2016/01/11

SECONDARY ACCESSION(S): PRJNA285284

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Tunable protein synthesis by transcript isoforms in human cells (Transcript Isoforms in Polysomes sequencing: TrIP-seq)

Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).

2016-01-11 | E-GEOD-69352 | biostudies-arrayexpress

Single-molecule, full-length transcript isoform sequencing reveals disease-associated RNA isoforms

Project description:Alternative splicing generates differing RNA isoforms that govern phenotypic complexity of eukaryotes. Its malfunction underlies many diseases, including cancer and cardiovascular diseases. Comparative analysis of RNA isoforms at the genome-wide scale has been difficult. Here, we established an experimental and computational pipeline that accurately quantifies transcript isoforms in their entire length from cDNA sequences with a full-length isoform detection accuracy of 97.6%. We generated a searchable, quantitative human transcriptome annotation with 31,025 known and 5,740 novel transcript isoforms (http://steinmetzlab.embl.de/iBrowser/). By analyzing the isoforms in the presence of RNA Binding Motif Protein 20 (RBM20) mutations associated with aggressive dilated cardiomyopathy (DCM), we identified 121 differentially expressed transcript isoforms in 107 cardiac genes. By establishing an isoform-differential expression test, our approach revealed that 11 of these genes displayed no detectable change in overall RNA expression. However, significant differences in the expression of specific isoforms in these genes was observed. These isoform specific effects demonstrate the need of analyzing RNA isoform expression levels rather than total gene expression levels.

2021-06-16 | E-MTAB-7334 | biostudies-arrayexpress

ESPRESSO: Robust discovery and quantification of transcript isoforms from error-prone long-read RNA-seq data

Project description:Long-read RNA sequencing (RNA-seq) holds great potential for characterizing transcriptome variation and full-length transcript isoforms, but the relatively high error rate of current long-read sequencing platforms poses a major challenge. We present ESPRESSO, a computational tool for robust discovery and quantification of transcript isoforms from error-prone long reads. ESPRESSO jointly considers alignments of all long reads aligned to a gene and uses error profiles of individual reads to improve the identification of splice junctions and the discovery of their corresponding transcript isoforms. On both a synthetic spike-in RNA sample and human RNA samples, ESPRESSO outperforms multiple contemporary tools in not only transcript isoform discovery but also transcript isoform quantification. In total, we generated and analyzed ~1.1 billion nanopore RNA-seq reads covering 30 human tissue samples and three human cell lines. ESPRESSO and its companion dataset provide a useful resource for studying the RNA repertoire of eukaryotic transcriptomes.

2022-10-14 | GSE192955 | GEO

Landscape of ribosome-engaged alternative transcript isoforms across neuronal cell classes

Project description:The goal of this project was to assess how alternative splicing programs are arrayed across neuronal cells types. We systematically mapped ribosome-associated transcript isoforms in genetically-defined neuron types of the mouse forebrain. The endogenous ribosomal protein Rpl22 was conditionally HA-tagged in glutamatergic neurons (using CamK2-cre for most neocortical pyramidal cells and Scnn1a-cre for spiny stellate and star pyramid layer 4 cells), and GABAergic interneurons [with somatostatin-cre (SST), parvalbumin-cre (PV) and vasointestinal peptide-cre (VIP)]. Within the hippocampus, we further targeted Cornu ammonis 1 (CA1) neurons (CamK2-cre), CA3 neurons (Grik4-cre), and SST-positive interneurons (SST-cre). Four replicates were deep sequenced (~100 million reads) using an Illumina platform. We find that neuronal transcript isoform profiles reliably distinguish even closely-related classes of pyramidal cells and inhibitory interneurons in the mouse hippocampus and neocortex, positing transcript diversification by alternative splicing as a central mechanism for the functional specification of neuronal cell types and circuits.

2019-07-01 | GSE133291 | GEO

Long read subcellular fractionation and sequencing reveals the translational fate of full length mRNA isoforms during neuronal differentiation

Project description:Alternative splicing (AS) alters the cis-regulatory landscape of mRNA isoforms leading to transcripts with distinct localization, stability and translational efficiency. To rigorously investigate mRNA isoform-specific ribosome association, we generated subcellular fractionation and sequencing (Frac-seq) libraries using both conventional short reads and long reads from human embryonic stem cells (ESC) and neural progenitor cells (NPC) derived from the same ESC. We performed de novo transcriptome assembly from high-confidence long reads from cytosolic, monosomal, light and heavy polyribosomal fractions and quantified their abundance using short reads from their respective subcellular fractions. Thousands of transcripts in each cell type exhibited association with particular subcellular fractions relative to the cytosol. Of the multi-isoform genes, 27% and 19% exhibited significant differential isoform sedimentation in ESC and NPC respectively. Alternative promoter usage and internal exon skipping accounted for the majority of differences between isoforms from the same gene. Random forest classifiers implicated coding sequence (CDS) and UTR lengths as important determinants of isoform-specific sedimentation profiles, and motif analyses reveal potential cell type-specific and subcellular fraction-associated RNA-binding protein signatures. Taken together our data demonstrate that alternative mRNA processing within the CDS and UTRs impacts the translational control of mRNA isoforms during stem cell differentiation, and highlights the utility of using a novel long-read sequencing-based method to study translational control.

2024-03-11 | GSE244655 | GEO

Differential transcript isoform usage pre- and post-zygotic genome activation in zebrafish

Project description:Zebrafish embryos are transcriptional silent until activation of the zygotic genome during the 10th cell cycle. Onset of transcription is followed by cellular and morphological changes involving cell speciation and gastrulation. Previous genome-wide surveys of transcriptional changes only assessed gene expression levels; however, recent studies have shown the necessity to map isoform-specific transcriptional changes. Here we perform isoform discovery and quantification on transcriptome sequences from before and after zebrafish zygotic genome activation (ZGA). We identify novel isoforms and isoform switches during ZGA for genes related to cell adhesion, pluripotency and DNA methylation. Isoform switching events include alternative splicing and changes in transcriptional start sites and in 3’ untranslated regions. New isoforms are identified even for well-characterized genes such as pou5f1, sall4 and dnmt1. Genes involved in cell-cell interactions such as f11r and magi1 display isoform switches with alterations of coding sequences. We also detect over 1000 transcripts that acquire a longer 3’ terminal exon when transcribed zygotically relative to the maternal transcript counterparts. ChIP-seq data mapped onto skipped exon events reveals a correlation between histone H3K36trimethylation peaks and the skipped exons, suggesting epigenetic marks being part of alternative splicing regulation. The novel isoforms and isoform switches reported here include regulators of the transcriptional, cellular and morphological changes taking place around ZGA. Our data display an array of isoform-related functional changes and represent a valuable resource complementary to existing early embryo transcriptomes. Examination H3K36me3 in zebrafish whole embryos at the Post-MBT stage

2012-11-01 | E-GEOD-40629 | biostudies-arrayexpress

Dynamics and consequences of widespread transcript isoform changes during neuronal differentiation

Project description:Static gene expression programs have been extensively characterized in stem cells and mature human cells. However, the dynamics of RNA isoform change upon cell-state transitions during cell differentiation, and the determinants and functional consequences have largely remained unclear. Here, we used an improved model for human neurogenesis in vitro that we show is amenable for systems-wide analyses of gene expression. Our multi-omics analysis reveals that the pronounced alterations in cell morphology correlate strongly with widespread changes in RNA isoform expression. Our approach identifies thousands of new RNA isoforms that are expressed at distinct stages during neurogenesis. RNA isoforms mainly arise from the alternative usage of transcription start sites and poly-adenylation sites as well as the skipping of individual exons during human neurogenesis. The transcript isoform changes can remodel the abundance and functions of protein isoforms. Finally, our study identifies a set of RNA-binding proteins as a likely determinant of differentiation stage-specific global isoform changes.

2024-04-11 | PXD046084 | Pride

Integrated Genomic Analysis Reveals Key Features of Long Undecoded Transcript Isoform (LUTI)-based Gene Repression

Project description:Long Undecoded Transcript Isoforms (LUTIs) represent a class of non-canonical mRNAs that downregulate gene expression through the combined act of transcriptional and translational repression. While single gene studies revealed some important aspects of LUTI-based repression, how these features impact gene regulation at a global scale is unknown. By using transcript leader and direct RNA sequencing, here we identify 74 LUTI candidates that are expressed specifically during meiotic prophase. Translational repression of these candidates is ubiquitous and dependent on upstream open reading frames. However, LUTI-based transcriptional repression is highly variable. In only 50% of the cases, LUTI transcription causes downregulation of the protein-coding transcript isoform. Higher LUTI expression, enrichment of histone 3 lysine 36 trimethylation, and changes in nucleosome position are the strongest predictors of LUTI-based transcriptional repression. We conclude that LUTIs downregulate gene expression in a manner that integrates translational repression, chromatin state changes, and the magnitude of LUTI expression.

2020-11-01 | GSE140177 | GEO

Identification of Common Genetic Variants that Account for Transcript Isoform Variation between Human Populations

Project description:In addition to the differences between populations in transcriptional and translational regulation of genes, alternative pre-mRNA splicing (AS) is also likely to play an important role in regulating gene expression and generating variation in mRNA and protein isoforms. Recently, the genetic contribution to transcript isoform variation has been reported in individuals of recent European descent. We report here results of an investigation of the differences in AS patterns between human populations. AS patterns in 176 HapMap lymphoblastoid cell lines derived from individuals of European and African ancestry were evaluated using the Affymetrix GeneChip Human Exon 1.0 ST Array. A variety of biological processes such as immune response and mRNA metabolic process were found to be enriched among the differentially spliced genes. The differentially spliced genes also include some involved in human diseases that have different prevalence or susceptibility between populations. The genetic contribution to the population differences in transcript isoform variation was then evaluated by a genome-wide association using the HapMap genotypic data on single nucleotide polymorphisms (SNPs). The results suggest that local and distant genetic variants account for a substantial fraction of the observed transcript isoform variation between human populations. Exon level expression on 176 HapMap cell lines.

2010-08-19 | E-GEOD-9703 | biostudies-arrayexpress

Differential transcript isoform usage pre- and post-zygotic genome activation in zebrafish

2012-11-01 | GSE40629 | GEO