Long read subcellular fractionation and sequencing reveals the translational fate of full length mRNA isoforms during neuronal differentiation
Ontology highlight
ABSTRACT: Alternative splicing (AS) alters the cis-regulatory landscape of mRNA isoforms leading to transcripts with distinct localization, stability and translational efficiency. To rigorously investigate mRNA isoform-specific ribosome association, we generated subcellular fractionation and sequencing (Frac-seq) libraries using both conventional short reads and long reads from human embryonic stem cells (ESC) and neural progenitor cells (NPC) derived from the same ESC. We performed de novo transcriptome assembly from high-confidence long reads from cytosolic, monosomal, light and heavy polyribosomal fractions and quantified their abundance using short reads from their respective subcellular fractions. Thousands of transcripts in each cell type exhibited association with particular subcellular fractions relative to the cytosol. Of the multi-isoform genes, 27% and 19% exhibited significant differential isoform sedimentation in ESC and NPC respectively. Alternative promoter usage and internal exon skipping accounted for the majority of differences between isoforms from the same gene. Random forest classifiers implicated coding sequence (CDS) and UTR lengths as important determinants of isoform-specific sedimentation profiles, and motif analyses reveal potential cell type-specific and subcellular fraction-associated RNA-binding protein signatures. Taken together our data demonstrate that alternative mRNA processing within the CDS and UTRs impacts the translational control of mRNA isoforms during stem cell differentiation, and highlights the utility of using a novel long-read sequencing-based method to study translational control.
Project description:Alternative splicing (AS) influences the expression of human genes in diverse ways. We previously used subcellular fraction-sequencing (Frac-Seq) to reveal an unexpected connection between alternative splicing and isoform-specific mRNA translation. Here we apply comparative transcriptomics to explore alternative splicing coupled translational control (AS-TC) across 13 million years of primate evolution. We used Frac-seq to identify polyribosome associated mRNA isoforms from human, chimpanzee and orangutan induced pluripotent stem cell lines. We discovered orthologous AS-TC events with either conserved or species-specific translation patterns. Exons sequences associated with similar sedimentation profiles between species show strong sequence conservation compared to orthologous exons with divergent sedimentation profiles, suggesting exonic cis-regulatory elements influence to translational control. To test this hypothesis we created luciferase reporters from orthologous exons with divergent sedimentation profiles differing by a single nucleotide. Remarkably, single nucleotide substitutions were sufficient to drive species-specific expression of luciferase reporters. Together these data establish that cis-acting elements regulate AS-TC across primate species.
Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5â?² and 3â?² untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5â?² untranslated regions exert robust translational control between cell lines, while 3â?² untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
Project description:Subcellular organization of RNAs and proteins is critical for cell function, but we still lack global maps and conceptual frameworks for how these molecules are localized in cells and tissues. Here we introduce ATLAS-Seq, which generates transcriptomes and proteomes from detergent-free tissue lysates fractionated across a sucrose gradient. Proteomic analysis of fractions confirmed separation of subcellular compartments. Unexpectedly, RNAs tended to co-sediment with other RNAs in similar protein complexes, cellular compartments, or biological functions. With the exception of those encoding secreted proteins, most RNAs sedimented differently than their encoded protein counterparts. To identify RNA binding proteins potentially driving these patterns, we correlated their sedimentation profiles to all RNAs, confirming known interactions and predicting new associations. Hundreds of alternative RNA isoforms exhibited distinct sedimentation patterns across the gradient, despite sharing most of their coding sequence. These observations suggest that transcriptomes can be organized into networks of co-segregating mRNAs encoding functionally related proteins, and provide insights into the establishment and maintenance of subcellular organization.
Project description:Long-read RNA-seq is now widely applied for gene isoform identification and efforts to long-read RNA-seq for gene isoform quantification are emerging. We develop a software named miniQuant to quantify gene isoforms using long reads alone or in combination with short reads. We demonstrate the utility of miniQuant by its application in uncovering the expression dynamics of gene isoforms during the differentiation of human embryonic stem cells (ESC) into pharyngeal endoderm (PE) and primordial germ cell-like cells (PGC).
Project description:We developed a hybrid-sequencing workflow, combining next-generation and third-generation sequencing, to reconstruct full-length transcriptomes. Integrating with polysome profiling and ribosome footprinting data, we predicted isoform–specific translational status and reconstructed ORFeome. Moreover, we identified isoforms with specific subcellular localization pattern in neurons.
Project description:Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5′ and 3′ untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5′ untranslated regions exert robust translational control between cell lines, while 3′ untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels.
Project description:Transcription factors (TFs) control gene expression by interacting with DNA and cofactors to regulate transcription. Human TF genes produce multiple protein isoforms with altered DNA binding domains, effector domains, and other protein regions. The global extent to which this results in functional differences between TF isoforms of the same gene remains unknown. Here, we systematically tested 693 isoforms of 246 TF genes, assessing DNA binding, protein binding, transcriptional activation, subcellular localization, and condensate formation. Compared to the reference isoform, two-thirds of alternative TF isoforms exhibit differences in their molecular activities, which often cannot be predicted from sequence alone. We observed two primary categories of alternative TF isoforms: “rewirers” and “negative regulators”, both of which are associated with differentiation and cancer. Our results support a model wherein the relative expression levels of and interactions between TF isoforms add an understudied layer of complexity to gene regulatory networks, demonstrating the importance of isoform-aware characterization of TF functions and providing a rich resource for further studies.
Project description:Alternative splicing increases the diversity of transcriptomes and proteomes in metazoans. The extent to which alternative splicing is active and functional in unicellular organisms is less understood. Here we exploit a single-molecule long-read sequencing technique and develop a computational tool, SpliceHunter, to characterize the transcriptome in the meiosis of fission yeast. We reveal 17017 alternative splicing events in 19741 novel isoforms at different stages of meiosis, including antisense and read-through transcripts. Intron retention is the major type of alternative splicing, followed by “alternate intron in exon”. 887 novel transcription units are detected; 60 of the predicted proteins show homology in other species and form theoretical stable structures. We compare the dynamics of novel isoforms based on the number of supporting full-length reads with those of annotated isoforms and explore the translational capacity and quality of novel isoforms. The evaluation of these factors indicates that the majority of novel isoforms are unlikely to be both condition-specific and translatable but the possibility of functional novel isoforms is not excluded. Together, this study highlights the diversity and dynamics at the isoform level in the sexual development of fission yeast.
Project description:The proper subcellular localization of RNAs and local translational regulation is crucial in highly compartmentalized cells, such as neurons. RNA localization is mediated by specific cis-regulatory elements usually found in mRNA 3'UTRs. Therefore, processes that generate alternative 3'UTRs – alternative splicing and polyadenylation – have the potential to diversify mRNA localization patterns in neurons. Here, we performed mapping of alternative 3'UTRs in neurites and soma isolated from mESC-derived neurons. Our analysis identified 593 genes with differentially localized 3'UTR isoforms. In particular, we have shown that two isoforms of Cdc42 gene with distinct functions in neuronal polarity are differentially localized between neurites and soma of mESC-derived and mouse primary cortical neurons, at both mRNA and protein level. Using reporter assays and 3'UTR swapping experiments, we have identified the role of alternative 3’UTRs and mRNA transport in differential localization of alternative CDC42 protein isoforms. Moreover, we used SILAC to identify isoform-specific Cdc42 3'UTR-bound proteome with potential role in Cdc42 localization and translation. Our analysis points to usage of alternative 3'UTR isoforms as a novel mechanism to provide for differential localization of functionally diverse alternative protein isoforms.
Project description:Alternative splicing (AS) is a key process underlying the expansion of proteomic diversity and the regulation of gene expression. However, the contribution of AS to the control of embryonic stem cell (ESC) pluripotency is not well understood. Here, we identify an evolutionarily conserved ESC-specific AS event that changes the DNA binding preference of the forkhead family transcription factor FOXP1. We show that the ESC-specific isoform of FOXP1 stimulates the expression of transcription factor genes required for pluripotency including OCT4, NANOG, NR5A2 and GDF3, while concomitantly repressing genes required for ESC differentiation. Remarkably, this isoform also promotes the maintenance of ESC pluripotency and the efficient reprogramming of somatic cells to induced pluripotent stem cells. These results thus reveal that an AS switch plays a pivotal role in the regulation of pluripotency and functions by controlling critical ESC-specific transcriptional programs. To identify genes potentially directly regulated by FOXP1-ES and FOXP1 in H9 ESCs, we performed chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-Seq). Using an antibody capable of efficiently immunoprecipitating both isoforms, >3400 significant ChIP-Seq peaks were detected across the human genome. To assess if these peaks are sites of FOXP1 and FOXP1-ES occupancy, we determined whether they are significantly enriched in individual PBM-derived 8-mers that bind to either or both isoforms.