Exome sequencing identifies somatic mutations of DDX3X in natural killer/T-cell lymphoma
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE69406 | GEO | 2015/06/03
SECONDARY ACCESSION(S): PRJNA285526
REPOSITORIES: GEO
Similar Datasets
Project description:With the whole genome SNP array information obtained from tumor and matched normal control, we could evaluate the acquired copy number alterations (CNAs) and uniparental disomies (UPDs) . Here we identified somatic mutations by whole-exome sequencing in 25 NKTCL patients and extended validation through targeted sequencing in an additional 80 cases.
2015-05-29 | GSE69382 | GEO
Project description:DDX3X is an ATP-dependent RNA helicase. Missense mutations in DDX3X gene are known to occur in WNT, SHH subgroup medulloblastomas. The role of DDX3X in medulloblastoma biology was studied by downregulating its expression in a SHH subgroup Daoy medulloblastoma cell line. DDX3X knockdown resulted in considerable reduction in proliferation, clonogenic potential and anchorage-independent growth of the medulloblastoma cells. Transcriptome analysis was performed to delineate the molecular mechanism underlying reduction in the malignant potential of the medulloblastoma cells upon DDX3X knockdown. Exogenous expression of three DDX3X missense mutants in the DDX3X knockdown cells could restore the malignant potential of the medulloblastoma cells.
2023-03-31 | GSE201967 | GEO
Project description:Whole-genome sequencing recently identified recurrent missense mutations in the RNA helicase DDX3X in pediatric medulloblastoma (MB) and other tumors. The normal function of DDX3X is poorly understood, and the consequences of its cancer-associated mutations have not been explored. Here we used genomic, biochemical, cell biological, and animal modeling approaches to investigate normal DDX3X function and the impact of cancer-associated DDX3X mutations. Cross-linking immunoprecipitation–high-throughput sequencing (CLIPseq) analyses revealed that DDX3X binds primarily to ~1000 mature mRNA targets at binding sites spanning the full mRNA length; their enrichment in the coding regions suggests that DDX3X plays a role in translational elongation. The association of wild-type DDX3X with polysomes is consistent with this observation. Cancer-associated mutations result in loss of DDX3X from polysomes and accumulation of mutant DDX3X in stress granules (cytoplasmic accumulations of translationally arrested mRNAs). Mutation-dependent redistribution of DDX3X to stress granules is also observed in a Drosophila model system and in MB tumor cells from patients carrying DDX3X mutations. Importantly, mRNAs targeted by DDX3X are enriched in translation factors, suggesting that DDX3X regulates translation both directly and indirectly. Indeed, depletion of DDX3X by RNAi or over-expression of mutant DDX3X significantly impairs global protein synthesis. Ribosome profiling confirmed this observation and showed a 5’ bias in ribosomal occupancy, further confirming the role of DDX3X in translational elongation. Together, our data show that DDX3X is a key regulator of translation and that this function is impaired by cancer-associated mutations. Finally, we found that medulloblastoma-related mutant DDX3X can efficiently bind the wild-type form suggesting that mutant DDX3X could exert a dominant negative effect in vivo.
2016-05-20 | GSE59095 | GEO
Project description:Whole-genome sequencing recently identified recurrent missense mutations in the RNA helicase DDX3X in pediatric medulloblastoma (MB) and other tumors. The normal function of DDX3X is poorly understood, and the consequences of its cancer-associated mutations have not been explored. Here we used genomic, biochemical, cell biological, and animal modeling approaches to investigate normal DDX3X function and the impact of cancer-associated DDX3X mutations. Cross-linking immunoprecipitation–high-throughput sequencing (CLIPseq) analyses revealed that DDX3X binds primarily to ~1000 mature mRNA targets at binding sites spanning the full mRNA length; their enrichment in the coding regions suggests that DDX3X plays a role in translational elongation. The association of wild-type DDX3X with polysomes is consistent with this observation. Cancer-associated mutations result in loss of DDX3X from polysomes and accumulation of mutant DDX3X in stress granules (cytoplasmic accumulations of translationally arrested mRNAs). Mutation-dependent redistribution of DDX3X to stress granules is also observed in a Drosophila model system and in MB tumor cells from patients carrying DDX3X mutations. Importantly, mRNAs targeted by DDX3X are enriched in translation factors, suggesting that DDX3X regulates translation both directly and indirectly. Indeed, depletion of DDX3X by RNAi or over-expression of mutant DDX3X significantly impairs global protein synthesis. Ribosome profiling confirmed this observation and showed a 5’ bias in ribosomal occupancy, further confirming the role of DDX3X in translational elongation. Together, our data show that DDX3X is a key regulator of translation and that this function is impaired by cancer-associated mutations. Finally, we found that medulloblastoma-related mutant DDX3X can efficiently bind the wild-type form suggesting that mutant DDX3X could exert a dominant negative effect in vivo.
2016-05-20 | GSE59093 | GEO
Project description:Whole-genome sequencing recently identified recurrent missense mutations in the RNA helicase DDX3X in pediatric medulloblastoma (MB) and other tumors. The normal function of DDX3X is poorly understood, and the consequences of its cancer-associated mutations have not been explored. Here we used genomic, biochemical, cell biological, and animal modeling approaches to investigate normal DDX3X function and the impact of cancer-associated DDX3X mutations. Cross-linking immunoprecipitation–high-throughput sequencing (CLIPseq) analyses revealed that DDX3X binds primarily to ~1000 mature mRNA targets at binding sites spanning the full mRNA length; their enrichment in the coding regions suggests that DDX3X plays a role in translational elongation. The association of wild-type DDX3X with polysomes is consistent with this observation. Cancer-associated mutations result in loss of DDX3X from polysomes and accumulation of mutant DDX3X in stress granules (cytoplasmic accumulations of translationally arrested mRNAs). Mutation-dependent redistribution of DDX3X to stress granules is also observed in a Drosophila model system and in MB tumor cells from patients carrying DDX3X mutations. Importantly, mRNAs targeted by DDX3X are enriched in translation factors, suggesting that DDX3X regulates translation both directly and indirectly. Indeed, depletion of DDX3X by RNAi or over-expression of mutant DDX3X significantly impairs global protein synthesis. Ribosome profiling confirmed this observation and showed a 5’ bias in ribosomal occupancy, further confirming the role of DDX3X in translational elongation. Together, our data show that DDX3X is a key regulator of translation and that this function is impaired by cancer-associated mutations. Finally, we found that medulloblastoma-related mutant DDX3X can efficiently bind the wild-type form suggesting that mutant DDX3X could exert a dominant negative effect in vivo.
2016-05-20 | GSE59094 | GEO
Project description:The sex chromosome-encoded RNA helicases DDX3X and DDX3Y play important roles in RNA metabolism. Heterozygous mutations of DDX3X frequently occur in cancers and neurodevelopmental disorders which have strong sex biases. However, how different DDX3X variants impair cellular function in sex specific genetic background is not understood. Herein, we found that DDX3X variants with significantly impaired ATPase activities demixed into the shells of unique hollow condensates, the dynamics of which were further differentiated by the RNA binding affinities of the different DDX3X variants. Proteomic and imaging studies revealed that DDX3X variant condensates sequestered wild-type DDX3X, DDX3Y, and other proteins important for various signaling pathways. Intriguingly, wild-type DDX3X improved the dynamics of heterogenous variant/wild-type hollow condensates more than DDX3Y. These results suggest that DDX3X variants with distinct enzymatic and condensation propensities may interact uniquely with wild-type DDX3X or DDX3Y to cause sex-specific cellular impacts.
2022-11-26 | MSV000090789 | MassIVE
Project description:DDX3X is a ubiquitously expressed RNA helicase involved in multiple stages of RNA biogenesis. DDX3X is frequently mutated in Burkitt lymphoma but the functional basis for this is unknown. Here, we show that loss-of-function DDX3X mutations are also commonly found in MYC-translocated diffuse large B cell lymphoma and reveal functional co-operation between mutant DDX3X and MYC. We show that DDX3X promotes translation of mRNAs encoding components of the core translational machinery, thereby driving global protein synthesis. Loss-of-function DDX3X mutations moderate MYC-driven global protein synthesis, thereby buffering MYC-induced proteotoxic stress during early lymphomagenesis. Established lymphoma cells subsequently restore full protein synthetic capacity by ectopic expression of DDX3Y, a Y-chromosome homologue that is normally expressed exclusively in testis. These findings highlight the vulnerability of MYC-driven lymphoma to proteotoxic stress and identify an unexpected male-specific mechanism of carcinogenesis, namely the commandeering of a testis-specific Y-chromosome gene to drive full malignant transformation.
2021-09-01 | GSE143393 | GEO
Project description:DDX3X is a ubiquitously expressed RNA helicase involved in multiple stages of RNA biogenesis. DDX3X is frequently mutated in Burkitt lymphoma but the functional basis for this is unknown. Here, we show that loss-of-function DDX3X mutations are also commonly found in MYC-translocated diffuse large B cell lymphoma and reveal functional co-operation between mutant DDX3X and MYC. We show that DDX3X promotes translation of mRNAs encoding components of the core translational machinery, thereby driving global protein synthesis. Loss-of-function DDX3X mutations moderate MYC-driven global protein synthesis, thereby buffering MYC-induced proteotoxic stress during early lymphomagenesis. Established lymphoma cells subsequently restore full protein synthetic capacity by ectopic expression of DDX3Y, a Y-chromosome homologue that is normally expressed exclusively in testis. These findings highlight the vulnerability of MYC-driven lymphoma to proteotoxic stress and identify an unexpected male-specific mechanism of carcinogenesis, namely the commandeering of a testis-specific Y-chromosome gene to drive full malignant transformation.
2021-09-01 | GSE144983 | GEO
Project description:Paralog dependency analysis of the DDX3X/DDX3Y genes through RNA-seq. Three types of KNS-42 cell lines are used in this experiment: one parental, one with a DDX3X over-expression (codon optimized) and one with DDX3Y over-expression (codon optimized). Targeting of the DDX3X gene is performed with guide RNAs 395 (TGGTACATGCGTATCCTTCA). The negative control is targeting AAVS1/PPP1R12C (AAVS1, GGGGCCACTAGGGACAGGAT). Samples were processed at 7 days after transduction. 3 independent repeats of the experiment were performed.
2022-04-06 | GSE190507 | GEO
Project description:DDX3X is frequently mutated in the WNT and SHH subtypes of medulloblastoma Ð the commonest malignant childhood brain tumor. But whether DDX3X functions as a medulloblastoma oncogene or tumor suppressor gene is not known. Here we show that Ddx3x regulates hindbrain patterning and development by controlling Hox gene expression and cell stress signaling. In mice predisposed to Wnt or Shh-medulloblastoma Ddx3x sensed oncogenic stress and suppressed tumor formation. WNT and SHH-medulloblastomas normally arise only in the lower and upper rhombic lips respectively. Deletion of Ddx3x relived this lineage restriction enabling both medulloblastoma subtypes to arise in either germinal zone. Thus DDX3X is a medulloblastoma tumor suppressor that regulates hindbrain development and restricts the competence of cell lineages to form medulloblastoma subtypes.
2020-03-19 | GSE147069 | GEO