Enhancer divergence and cis-regulatory evolution in the human and chimpanzee neural crest
Ontology highlight
ABSTRACT:
ORGANISM(S): Pan troglodytes Homo sapiens
PROVIDER: GSE70751 | GEO | 2015/09/11
SECONDARY ACCESSION(S): PRJNA289483
REPOSITORIES: GEO
Similar Datasets
Project description:Here we derive human and chimpanzee cranial neural crest cells (CNCCs) and profile histone modifications, transcription factors, chromatin accessibility and gene expression to systematically and quantitatively annotate evolutionary divergence of craniofacial cis-regulatory landscapes. Histone modifications (H3K27ac, H3K4me1, H3K4me3, H3K27me3), chromatin modifiers (p300), transcription factors (NR2F1, TFAP2A), chromatin accessibility (ATACseq) and gene expression (RNAseq) were assayed in CNCCs derived from iPSCs/ESCs from 2 chimpanzee and 3 human individuals.
2015-09-11 | E-GEOD-70751 | biostudies-arrayexpress
Project description:Gene regulatory divergence is thought to play a central role in determining human-specific traits. However, our ability to link divergent regulation to divergent phenotypes is limited. Here, we utilized human-chimpanzee hybrid induced pluripotent stem cells to study divergent gene expression separating these species. The hybrid cells allowed us to separate cis- from trans-regulatory effects, and to control for non-genetic factors that often confound comparative studies. We differentiated these cells into cranial neural crest cells (CNCCs), the primary cell type giving rise to the face, and used the hybrid cells to generate a catalogue of divergent cis-regulatory gene expression between humans and chimpanzees. We found that cis-regulatory divergence is tightly linked to phenotypic divergence, enabling the identification of candidate genes associated with several divergent traits. Specifically, we find support for lineage-specific selection acting on the cis-regulation of the hedgehog signaling pathway. This pathway includes EVC2 (LIMBIN), whose cis-regulation is among the most divergent in the genome, resulting in 6-fold down-regulation along the human lineage. We found that inducing a similar reduction in EVC2 levels substantially reduces Hh signaling output. Mice and humans lacking functional EVC2 show striking parallels to many human-chimpanzee phenotypic differences, particularly in the skull and face, suggesting that the regulatory divergence of Hh signaling may have contributed to the unique craniofacial morphology of humans. In sum, our results suggest that human-chimpanzee hybrid cells can serve as a valuable resource to study the evolution of gene regulation and its impact on phenotypic divergence. SRA/fastq files include Illumina adapters (GATCGGAAGAGCACACGTCT and GATCGGAAGAGCGTCGTGTA).
2020-10-09 | GSE146481 | GEO
Project description:Craniofacial development involves regulation of a compendium of transcription factors, signaling molecules and epigenetic regulators. Histone deacetylases (HDACs) are involved in the regulation of cell proliferation, differentiation and homeostasis across a wide range of tissues, such as brain, cardiovascular system, muscular system, and skeletal system. However, functional role of Hdac4 during craniofacial development is still unclear. In this study, we investigated the effects of Hdac4 knockout in craniofacial skeletal development by conditionally disrupting the Hdac4 gene in cranial neural crest cells (CNCCs) using Cre-mediated recombination. Mice deficient in Hdac4 in CNCCs-derived osteoblasts demonstrated a dramatic decrease in bone formation in frontal bone. In vitro pre-osteoblasts (MC3T3-E1 cells) lacking Hdac4 exhibited reduced proliferation activity in association with dysregulation of cell cycle-related genes. These findings suggest that Hdac4 acts partially as a regulator of craniofacial skeletal development by positively regulating proliferation of CNCCs-derived osteoblasts.
2022-03-09 | GSE186707 | GEO
Project description:Enhancer-promoter interactions preferentially occur within boundary-insulated topologically associating domains (TADs), limiting inter-TAD interactions. Enhancer clusters in linear proximity, termed super-enhancers (SEs), ensure high target gene expression levels. Little is known about SE topological regulatory impact during craniofacial development. Here, we identified 2232 genome-wide putative SEs in mouse cranial neural crest cells (CNCCs), 147 of which target genes establishing CNCC positional identity during face formation. In second pharyngeal arch (PA2) CNCCs, a multiple SE-containing region, partitioned into Hoxa Inter-TAD Regulatory Element 1 and 2 (HIRE1 and HIRE2), establishes long-range inter-TAD interactions selectively with Hoxa2, that is required for external and middle ear structures. HIRE2 deletion in a Hoxa2 haploinsufficient background results in microtia. HIRE1 deletion phenocopies the full homeotic Hoxa2 knockout phenotype and induces PA3 and PA4 CNCC abnormalities correlating with Hoxa2 and Hoxa3 transcriptional downregulation. Thus, SEs can overcome TAD insulation and regulate anterior Hoxa gene collinear expression in a CNCC subpopulation-specific manner during craniofacial development.
2023-04-28 | GSE211902 | GEO
Project description:Enhancer-promoter interactions preferentially occur within boundary-insulated topologically associating domains (TADs), limiting inter-TAD interactions. Enhancer clusters in linear proximity, termed super-enhancers (SEs), ensure high target gene expression levels. Little is known about SE topological regulatory impact during craniofacial development. Here, we identified 2232 genome-wide putative SEs in mouse cranial neural crest cells (CNCCs), 147 of which target genes establishing CNCC positional identity during face formation. In second pharyngeal arch (PA2) CNCCs, a multiple SE-containing region, partitioned into Hoxa Inter-TAD Regulatory Element 1 and 2 (HIRE1 and HIRE2), establishes long-range inter-TAD interactions selectively with Hoxa2, that is required for external and middle ear structures. HIRE2 deletion in a Hoxa2 haploinsufficient background results in microtia. HIRE1 deletion phenocopies the full homeotic Hoxa2 knockout phenotype and induces PA3 and PA4 CNCC abnormalities correlating with Hoxa2 and Hoxa3 transcriptional downregulation. Thus, SEs can overcome TAD insulation and regulate anterior Hoxa gene collinear expression in a CNCC subpopulation-specific manner during craniofacial development.
2023-04-28 | GSE211901 | GEO
Project description:Enhancer-promoter interactions preferentially occur within boundary-insulated topologically associating domains (TADs), limiting inter-TAD interactions. Enhancer clusters in linear proximity, termed super-enhancers (SEs), ensure high target gene expression levels. Little is known about SE topological regulatory impact during craniofacial development. Here, we identified 2232 genome-wide putative SEs in mouse cranial neural crest cells (CNCCs), 147 of which target genes establishing CNCC positional identity during face formation. In second pharyngeal arch (PA2) CNCCs, a multiple SE-containing region, partitioned into Hoxa Inter-TAD Regulatory Element 1 and 2 (HIRE1 and HIRE2), establishes long-range inter-TAD interactions selectively with Hoxa2, that is required for external and middle ear structures. HIRE2 deletion in a Hoxa2 haploinsufficient background results in microtia. HIRE1 deletion phenocopies the full homeotic Hoxa2 knockout phenotype and induces PA3 and PA4 CNCC abnormalities correlating with Hoxa2 and Hoxa3 transcriptional downregulation. Thus, SEs can overcome TAD insulation and regulate anterior Hoxa gene collinear expression in a CNCC subpopulation-specific manner during craniofacial development.
2023-04-28 | GSE211903 | GEO
Project description:Enhancer-promoter interactions preferentially occur within boundary-insulated topologically associating domains (TADs), limiting inter-TAD interactions. Enhancer clusters in linear proximity, termed super-enhancers (SEs), ensure high target gene expression levels. Little is known about SE topological regulatory impact during craniofacial development. Here, we identified 2232 genome-wide putative SEs in mouse cranial neural crest cells (CNCCs), 147 of which target genes establishing CNCC positional identity during face formation. In second pharyngeal arch (PA2) CNCCs, a multiple SE-containing region, partitioned into Hoxa Inter-TAD Regulatory Element 1 and 2 (HIRE1 and HIRE2), establishes long-range inter-TAD interactions selectively with Hoxa2, that is required for external and middle ear structures. HIRE2 deletion in a Hoxa2 haploinsufficient background results in microtia. HIRE1 deletion phenocopies the full homeotic Hoxa2 knockout phenotype and induces PA3 and PA4 CNCC abnormalities correlating with Hoxa2 and Hoxa3 transcriptional downregulation. Thus, SEs can overcome TAD insulation and regulate anterior Hoxa gene collinear expression in a CNCC subpopulation-specific manner during craniofacial development.
2023-04-28 | GSE211900 | GEO
Project description:Enhancer-promoter interactions preferentially occur within boundary-insulated topologically associating domains (TADs), limiting inter-TAD interactions. Enhancer clusters in linear proximity, termed super-enhancers (SEs), ensure high target gene expression levels. Little is known about SE topological regulatory impact during craniofacial development. Here, we identified 2232 genome-wide putative SEs in mouse cranial neural crest cells (CNCCs), 147 of which target genes establishing CNCC positional identity during face formation. In second pharyngeal arch (PA2) CNCCs, a multiple SE-containing region, partitioned into Hoxa Inter-TAD Regulatory Element 1 and 2 (HIRE1 and HIRE2), establishes long-range inter-TAD interactions selectively with Hoxa2, that is required for external and middle ear structures. HIRE2 deletion in a Hoxa2 haploinsufficient background results in microtia. HIRE1 deletion phenocopies the full homeotic Hoxa2 knockout phenotype and induces PA3 and PA4 CNCC abnormalities correlating with Hoxa2 and Hoxa3 transcriptional downregulation. Thus, SEs can overcome TAD insulation and regulate anterior Hoxa gene collinear expression in a CNCC subpopulation-specific manner during craniofacial development.
2023-04-28 | GSE211899 | GEO
Project description:To assess the effects of SOX9 depletion on transcription in hESC-derived cranial neural crest cells, we performed genome editing of the H9 hESC lines to tag SOX9 with FKBPV36, V5, and mNeonGreen. Upon differentiating edited hESC to cranial neural crest cells using an established protocol, addition of the degrader molecule dTAGV-1 results in SOX9 depletion. We then profiled transcription by metabolic labeling of RNA (SLAM-Seq) in undepleted CNCCs or CNCCs in which SOX9 was depleted for 3h or 24h
2022-07-04 | GSE205903 | GEO
Project description:The overall goal of this project is to investigate the role of TGF-beta signaling in tissue-tissue interactions between myogenic precursors of craniofacial muscles and cranial neural crest cells (CNCCs). Here, we conducted gene expression profiling of the tongue bud from mice at embryonic day E13.5 with a CNCC-specific conditional inactivation of the TGF-beta receptor type 1 gene Alk5. These mice provide a model of microglossia as well as disrupted extraocular and masticatory muscle development, which are congenital birth defects commonly observed in several syndromic conditions. To investigate the adverse effects of dysfunctional TGF-beta signaling on tissue-tissue interactions between CNCCs and myogenic precursors of craniofacial muscles, we analyzed tongue bud tissue of mice with a CNCC-specific conditional inactivation of Alk5 (Wnt1-Cre; Alk5 fl/fl). We performed microarray analyses of the tongue bud of Alk5 fl/fl control mice and Wnt1-Cre; Alk5 fl/fl mutant mice, collected at embryonic day E13.5 (n=4 per group).
2014-06-18 | E-GEOD-52358 | biostudies-arrayexpress