Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Determination of RNA Secondary Structure By RNA-Sequencing of HEK293T Cells

ABSTRACT: RNA molecule fold into three dimensional structures in order to fill important roles in the cell such as translation and post-transcriptional regulation. These three dimensional structures, in turn, depend on the pattern of hydrogen bonds between ribonucleotides. We employ a technique based on high throughput RNA Sequencing (RNA-Seq) to uncover this patter on a transcriptome wide scale.

ORGANISM(S): Homo sapiens

PROVIDER: GSE72681 | GEO | 2016/05/17

SECONDARY ACCESSION(S): PRJNA294657

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Determination of RNA Secondary Structure By RNA-Sequencing of HEK293T Cells

Project description:RNA molecule fold into three dimensional structures in order to fill important roles in the cell such as translation and post-transcriptional regulation. These three dimensional structures, in turn, depend on the pattern of hydrogen bonds between ribonucleotides. We employ a technique based on high throughput RNA Sequencing (RNA-Seq) to uncover this patter on a transcriptome wide scale. We take advantage of two ribonucleases that have structure specific activity. RNAse S1 specifically digests single stranded RNA while RNAse V1 is specific to double stranded RNA. We aliquot each of our sample into to reactions. One is thoroughly treated with RNAse S1, digesting away single stranded RNA and leaving behind dsRNA. The other is treated with RNAse V1, which has the inverse effect. The surviving dsRNA and ssRNA molecules are then subject to high throughput sequencing. The resulting reads are used to generate a structure score, revelaing which regions of each transcript are involved in base pairing and which are unpaired.

2016-05-17 | E-GEOD-72681 | biostudies-arrayexpress

RNA-seq analysis of wild-type HEK293, HEK293 treated with DMSO, ML216 or NSC617145, wild-type mESCs and dhx9KO mESCs

Project description:G4s are built by stacked guanine tetrads connected via Hoogsteen hydrogen bonds and can be formed by intra- or inter-molecular folding of the tetramers. R-loops are three-stranded structures which contain a DNA-RNA hybrid and a displaced single-stranded DNA. Both G4s and R-loops are involved in key biological processes, including transcriptional regulation, replication, genomic instability, class switch recombination in B cells, DNA damage and repair, and telomere maintenance. To understand the transcriptional regulation of G4s and R-loops, we performed the RNA-seq analysis on HEK293 cells treated with the inhibitors of G4 resolving helicase ML216 or NSC617145 and mESCs in which the resolving helicase DHX9 of G4 and R-loop was knockout.

2024-07-25 | GSE254763 | GEO

Mus musculus

Project description:Allele-specific chromatin three-dimensional structures of hybrid mice

| PRJNA1066546 | ENA

ssDNA aptamers against amyloid-β peptide as biomarker and inhibtor [SELEX]

Project description:We report high-affinity ssDNA aptamers as biomarkers and antagonists of amyloid-β peptide. We generated three novel aptamer sequences from the pool of aptamers through the SELEX process, and evaluated their affinity and sensitivity using enzyme-linked immunosorbent assay (ELISA). (The forward primer: ATTAGTCAAGAGGTAGACGCACATA, reverse primer TTCTGGTCGTCGTGACTCCTAT) The ssDNA aptamers modeled into a three-dimensional structure; interaction and mechanism of action derived through molecular dynamics simulations (MD). MD simulations revealed the nature of binding and inhibition of aggregation by binding with amyloid-β peptide monomers, dimers, and other oligomers. The presence of high non-bonded interaction energy along with hydrogen bonds constitutes the complex structure of the aptamer-amyloid-β peptide. Furthermore, the changes in the secondary structure induced by aptamers may help remove the peptide through the blood-brain barrier. This study provided a framework for the application of aptamers against amyloid-β peptides as biomarkers and antagonists.

2019-09-30 | GSE124865 | GEO

Project description:three-phase three-dimensional electrode

| PRJNA661628 | ENA

Single-cell three dimensional genome structures of rice egg, sperm, and unicellular zygote

Project description:Single-cell three dimensional genome structures of rice egg, sperm, and unicellular zygote

| PRJNA507566 | ENA

Molecular basis for coordinating secondary metabolite production by bacterial and plant signaling molecules

Project description:The production of secondary metabolites is one of the major mechanisms for beneficial rhizobacteria to antagonize plant pathogens. However, simultaneously producing large quantities of different secondary metabolites can pose great metabolic burdens and exerts a significant fitness cost on the producers. Here, we showed that PhlH from the rhizobacterium Pseudomonas fluorescens is a TetR-family regulator that plays a central role in coordinating biosynthesis of several secondary metabolites including 2,4-diacetylphloroglucinol (2,4-DAPG), mupirocin, and pyoverdine. Structures of PhlH in both its apo-form and 2,4-DAPG-bound were also presented, elucidating its ligand-recognizing and allosteric switching mechanisms. The ligand 2,4-DAPG was fully buried in a long hydrophobic interior tunnel and subsequent docking and mutagenesis analysis confirmed that this tunnel could also be occupied by the plant flavonoid phloretin, providing a structural basis for the ligand-binding promiscuity in PhlH. Moreover, dissociation of 2,4-DAPG from the ligand-binding domain (LBD) alone was sufficient to allosterically trigger a pendulum-like movement of the DNA-binding domains (DBD) within the PhlH dimer, leading to a closed to open conformational transition. Molecular dynamics simulation further confirmed that these two distinct conformational states were stabilized by specific hydrogen bonding interactions and disruption of these hydrogen bonds had profound effects on signal transmission from LBD to DBD. These findings revealed a potential route of allosteric signal transduction, which is well-conserved in numerous PhlH-like regulators and provides novel insights into ligand-triggered conformational switching of TetR-family regulators.

2021-04-15 | PXD025403 |

Footprinting SHAPE-eCLIP reveals transcriptome-wide hydrogen bonds at RNA-protein interfaces

Project description:Footprinting SHAPE-eCLIP reveals transcriptome-wide hydrogen bonds at RNA-protein interfaces

| PRJNA630074 | ENA

Modeling Human Cortical Development in vitro using induced Pluripotent Stem Cells

Project description:Human iPSCs grown in suspension in the presence of rostral neuralizing factors generated three-dimensional structures containing polarized radial glia, intermediate progenitors and a spectrum of layer-specific cortical neurons reminiscent of their organization in vivo. The hiPSC-derived multilayered structures express a gene expression profile typical of the embryonic telencephalon, but not that of other CNS regions.

2012-10-19 | GSE41565 | GEO

The essential Schizosaccharomyces pombe Pfh1 DNA helicase promotes fork movement past G-quadruplex motifs to prevent DNA damage

Project description:Background G-quadruplexes (G4s) are stable non-canonical DNA secondary structures consisting of stacked arrays of four guanines, each held together by Hoogsteen hydrogen bonds. Sequences with the ability to form these structures in vitro, G4 motifs, are found throughout bacterial and eukaryotic genomes. The budding yeast Pif1 DNA helicase, as well as several bacterial Pif1 family helicases, unwind G4 structures robustly in vitro and suppress G4-induced DNA damage in S. cerevisiae in vivo. Results We determined the genomic distribution and evolutionary conservation of G4 motifs in four fission yeast species and investigated the relationship between G4 motifs and Pfh1, the sole S. pombe Pif1 family helicase. Using chromatin immunoprecipitation combined with deep sequencing, we found that many G4 motifs in the S. pombe genome were associated with Pfh1. Cells depleted of Pfh1 had increased fork pausing and DNA damage near G4 motifs, as indicated by high DNA polymerase occupancy and phosphorylated histone H2A, respectively. In general, G4 motifs were underrepresented in genes. However, Pfh1-associated G4 motifs were located on the transcribed strand of highly transcribed genes significantly more often than expected, suggesting that Pfh1 has a function in replication or transcription at these sites. Conclusions In the absence of functional Pfh1, unresolved G4 structures cause fork pausing and DNA damage of the sort associated with human tumors.

2014-12-03 | GSE59178 | GEO

OmicsDI is part of the ELIXIR infrastructure

OmicsDI is an Elixir interoperability service. Learn more ›

Tweets

OmicsDI Databases

PRIDE
PeptideAtlas
MassIVE
JPOST Repository
Physiome Model Repository

EGA
EVA
ENA
LINCS
PAXDB
Cell Collective

MetaboLights
Metabolomics Workbench
MetabolomeExpress
GNPS
BioModels
FAIRDOMHub

ArrayExpress
dbGaP
ExpressionAtlas
GEO
NODE

Information

Databases
Help
API
Contact us
Code on GitHub
Terms of use
Submit Data