Browse
Submit Data
Databases
API
Help

Dataset Information

0 Views

0 Connections

0 Citations

0 Reanalyses

0 Downloads

Omics score: 0

Transcriptome analysis in HT29 and SW480 cells depleted of Prdx2

ABSTRACT: Prdx2 is the thioredoxin-dependent peroxidase that reduces H2O2 using reducing power NADPH in the presence of thioredoxin and thioredoxin reductase. Prdx2 plays an important role in growth. factor signaling in mammlian cells. Therefore, we examined the gene expression in colon adenocarcinoma cell line HT29 after Prdx2 depletion. Prdx2 depletion resulted in a significant alteration on gene expression, including protein synthesis, metabolisms, and cell cycle.

ORGANISM(S): Homo sapiens

PROVIDER: GSE81429 | GEO | 2017/05/13

SECONDARY ACCESSION(S): PRJNA321515

REPOSITORIES: GEO

ACCESS DATA

Json Xml

Dataset's files

Source:

			Action	DRS
		Other

Items per page:

1 - 1 of 1

Similar Datasets

Expression data from shROR HT29 and AGS cell

2015-06-05 | GSE67416 | GEO

Expression data from shROR HT29 and AGS cell

Project description:Genome-wide cDNA array from HT29,HT29-shROR,HT29-Mock, AGS, AGS-shROR, AGS-Mock cells We used microarrays to detail the global programme of gene expression and identified significantly changed genes after ROR depletion. HT29,HT29-shROR, HT29-Mock, AGS, AGS-shROR, AGS-Mock cells were selected for RNA extraction and hybridization on Affymetrix microarrays.

2015-06-05 | E-GEOD-67416 | biostudies-arrayexpress

ERbeta modulation of NFkB pathway in colon cancer cell lines SW480 and HT29

2020-08-13 | GSE65979 | GEO

ERbeta modulation of NFkB pathway in colon cancer cell lines SW480 and HT29

Project description:Analysis of differentially expressed genes in colon cancer cell lines SW480 and HT29 with and without stably expressed ERbeta gene, with and without 10ng/mL TNFa treatment for 2 and 24 hours. Total RNA obtained from colon cancer cell lines SW480 and HT29 with and without stably expressed ERbeta gene, with and without 10ng/mL TNFa treatment for 2 and 24 hours.

2016-07-17 | E-GEOD-65979 | biostudies-arrayexpress

RNA-seq analysis of colorectal cancer cell lines HT29-POLR1D-silenced and SW480-POLR1D-silenced

Project description:Purpose: To explore the effect of POLR1D on colorectal cancer cell lines HT29 and SW480. Methods: Whole transcriptome profiles of POLR1D knock down and AllStars Negative Control transfected colorectal cancer cell line (ie. HT29 and SW480) were generated by whole transcriptome sequencing, in replicate, using the Illumina NextSeq 550. The sequence reads that passed quality filters were analyzed at the gene level with Kallisto followed by DESeq2. Results: 45 genes showed consistent change after silencing of POLR1D, which included 2 genes that are well-known to be involved in the cell growth-related pathway, ie. VEGFA and EREG. Conclusions: POLR1D can infulence cell proliferation through VEGFA and EREG related pathway.

2019-11-12 | GSE140198 | GEO

SLC25A25-AS1 knockdown data of two colorectal carcinoma cell lines (HT29 and SW480)

Project description:We identified that SLC25A25-AS1 was a lncRNA influencing radiation response. Therefore, we aimed to explore more biological roles of SLC25A25-AS1 in this process. Towards this end, we used RNA interference (RNAi)-mediated knockdown of SLC25A25-AS1 in HT29 and SW480 to explore the changes of mRNA expression profiles and explore the phenotype outcomes.

2017-03-03 | GSE95605 | GEO

HT29 and GATA6

Project description:HT29 and GATA6

| PRJNA263819 | ENA

Diverse effect of WWOX overexpression in HT29 and SW480 colon cancer cell lines.

Project description:WW-domain-containing oxidoreductase (WWOX) is the tumour suppressor gene from the common fragile site FRA16D, whose altered expression has been observed in tumours of various origins. Its suppressive role and influence on basic cellular processes such as proliferation and apoptosis have been confirmed in many in vitro and in vivo studies. Moreover, its protein is thought to take part in the regulation of tissue morphogenesis and cell differentiation. However, its role in colon cancer formation remains unclear. The aim of this study was to characterize the influence of WWOX on the process of colon cancerogenesis, the basic features of the cancer cell and its expression profiles. Multiple biological tests, microarray experiments and quantitative reverse transcriptase (RT)-PCR were performed on two colon cancer cell lines, HT29 and SW480, which differ in morphology, expression of differentiation markers, migratory characteristics and metastasis potential and which represent negative (HT29) and low (SW480) WWOX expression levels. The cell lines were subjected to retroviral transfection, inducting WWOX overexpression. WWOX was found to have diverse effects on proliferation, apoptosis and the adhesion potential of modified cell lines. Our observations suggest that in the HT29 colon cancer cell line, increased expression of WWOX may result in the transition of cancer cells into a more normal colon epithelium phenotype, while in SW480, WWOX demonstrated well-known tumour suppressor properties. Our results also suggest that WWOX does not behave as classical tumour suppressor gene, and its influence on cell functioning is more global and complicated.

| S-EPMC4190457 | biostudies-literature

Transcriptome expression changes after knockdown of ALDH1A1 in human colon cancer cells HT29

Project description:Firstly, shRNA (GCCAAATCATTCCTTGGAATT) was used to knock down ALDH1A1 in HT29 cells, and the knockdown effect was verified by western blot. Then the shALDH1A1 HT29 cells were compared with parental HT29 cells by RNA-seq.

2024-08-27 | GSE225822 | GEO

Homo sapiens

Project description:Transcriptome analysis in HT29 and SW480 cells depleted of Prdx2

| PRJNA321515 | ENA