Project description:We report the single cell RNA sequencing on HT29 colorectal cancer line with 100 nM dasatinib treatment after double thymidine block.
Project description:To investigate the biological function ALDOA in the colorectal cancer, we established HT29 cell lines in which the ALDOA gene has been knocked down by the small interfering RNA (siRNA) technique. We used a siRNA targeting ALDOA (KD) to knockdown ALDOA expression in HT29 cells. A scrambled siRNA (NC) was used as a control. Then RNA-Seq experiment was performed by Novogene Co., Ltd. (Beijing, China) to analyze gene expression changes in HT29 cells. For each sample, three independent biological replicates were performed.
Project description:Firstly, shRNA (GCCAAATCATTCCTTGGAATT) was used to knock down ALDH1A1 in HT29 cells, and the knockdown effect was verified by western blot. Then the shALDH1A1 HT29 cells were compared with parental HT29 cells by RNA-seq.
Project description:Genome-wide cDNA array from HT29,HT29-shROR,HT29-Mock, AGS, AGS-shROR, AGS-Mock cells We used microarrays to detail the global programme of gene expression and identified significantly changed genes after ROR depletion. HT29,HT29-shROR, HT29-Mock, AGS, AGS-shROR, AGS-Mock cells were selected for RNA extraction and hybridization on Affymetrix microarrays.
Project description:Genome-wide cDNA array from HT29,HT29-shROR,HT29-Mock, AGS, AGS-shROR, AGS-Mock cells We used microarrays to detail the global programme of gene expression and identified significantly changed genes after ROR depletion.
Project description:Purpose: To identify differentially expressed genes in HT29 colon cancer cells after treatment with a novel formulation of camptothecin with β-cyclodextrin-EDTA-Fe3O4 nanoparticle-conjugated nanocarriers (CPT-CEF) Methods:Treated HT29 cell lines with CPT-CEF, isolated total RNA from HT29 colon cancer cells, and prepared library for RNA sequencing. Carried out comparative transcriptomic studies between treated and untreated cells to find out which gene functions were dysregulated by CPT-CEF. Results: The study yielded 247 DEGs ((FDR<0.05, FC>2.0) that were affected by CPT-CEF treatment in the HT29 colon cancer cells. The results obtained from cell cycle analysis, mitochondrial depolarization assay and acridium orange/propidium iodide double staining showed potential of CPT-CEF in cancer cell inhibition. Conclusion: Our study successfully identified DEGs in the CPT-CEF treated HT29 colon cancer cells that pointed to inhibition of cancer progression. To further affirm, animal studies are needed.
Project description:HT29 cells was infected with EV71 at MOI 1 or nil respectively and harvested at 36hpi We use miRNA microarray to profile and identify miRNA which are up or down regulated due to EV71 infection
