The effect of RPN9 silencing in N. benthamiana
Ontology highlight
ABSTRACT:
ORGANISM(S): Nicotiana benthamiana Solanum tuberosum
PROVIDER: GSE8259 | GEO | 2007/09/01
SECONDARY ACCESSION(S): PRJNA101213
REPOSITORIES: GEO
Similar Datasets
Project description:N. benthamiana plants were grown under 16 hour light/8 hour dark cycle in a plant growth room at 24°C for approximately six weeks before subjected to virus-induced gene silencing. Agrobacterium stain GV2260 (OD600=1.0) carrying silencing constructs were infiltrated into 2 fully expended leaves for inducing gene silencing. Samples were collected at 8, 10, 12, 14, and 16 days post Agro-inoculation (DPI) for RPN9-silenced plants and N-silenced control. For RPN8-silencing, samples were collected at 8, 10, and 12 DPI, and the empty vector treated plants were used as a control. Each sample was a pool of 6 silenced leaves collected from 3 individual plants. All the samples were in biological triplicates from 3 sets of independently silenced plants. Total RNA was extracted using Trizol and DNA was removed with DNase I treatment before cDNA synthesis. Keywords: Reference design 25 hybs total
2007-09-01 | E-GEOD-8259 | biostudies-arrayexpress
Project description:Potato cultivar Russet Norkotah was grown in a growth chamber at 16 hour light/8 hour dark at 22°C fertilized with Osmocote. Plants were from tissue culture, transplanted to soil and used approximately 4 weeks after transplanting. RNA was extracted from leaves using Trizol. Plants were sprayed with one of four treatments, either 1mM salicylic acid, 100 µM methyl jasmonate, 1 mg/ml arachidonic acid or 100 µM methyl jasmonate plus 1 mM salicylic acid together. Samples were harvested at 3, 24 and 72 hours after spraying. Each salicylic acid or arachidonic acid treatment has 3 biological replicates done in parallel, using leaves pooled from 2 plants. The control for SA or AA treated plants were water sprayed plants, from which leaves of 3 different plants were pooled at each timepoint, done side-by-side with the treated samples. Methyl jasmonate or MJ+SA treatments had 2 biological replicates each, using leaves pooled from 2 plants. A separate set of water sprayed plants (from the SA and AA control treatments) were used as controls, and pooled leaves from 3 plants were used at each time-point, and done in parallel with the treated samples. Keywords: Direct comparison
2007-09-01 | GSE8208 | GEO
Project description:LapA encodes an acidic leucine aminopeptidase that is wound-inducible and found only in tomato (Solanum lycopersicum) and a small subset of the Solanaceae. LapA is expressed in developing flowers, fruit and in foliage after wounding, insect feeding (Manduca sexta), Pseudomonas syringae pv. tomato infection, salinity, and water-deficit stress. Using Agrobacterium tumefaciens, UC82b plants were transformed with a chimeric gene containing the CaMV 35S promoter and LapA cDNA in the sense orientation. Kanamycin-resistant plants were screened by RNA and protein blots to identify plants that did not accumulate and LAP-A protein upon wounding; these plants were designated LapA-silenced (LapA-SI) lines. The LapA-SI plants have an impaired wound response and do not accumulate wound response transcripts (proteinase inhibitors and polyphenol oxidase) to wild-type levels. LAP-A is the first aminopeptidase to be shown to have a regulatory role in plants. LapA-SI and UC82b plants were germinated on filter paper for 7 days before being planted in soil. Plants were grown in a growth chamber, (16 hour days at 28°C, 8 hour nights at 24°C, 50% humidity) for three weeks. Plants were wounded by crushing each leaflet on each of two lower leaves with pliers. Wounded leaves were collected at 0, 1 and 8 hr (local wounded tissue). Two upper, unwounded leaves were collected from the same plants at the same times (systemically wounded tissue). Five to seven plants were pooled for each time point. The experiment was repeated three times. RNA was extracted using a hot phenol/LiCl protocol and purified and DNase treated using the SV Total RNA Isolation Kit from Promega. Keywords: Reference design
2007-09-01 | GSE8236 | GEO
Project description:To understand how endosperm and embryo perceive temperature signals to control seed vigour in Brassica oleracea, we grow plants in 16°C till bent-cotyledon stage, which is a key stage sensing temperature. Then plants were either transferred to 26°C or kept in 16°C. Endosperm/seed coat and embryo RNA samples were collected for RNA-seq at day0, day1, day3, day7, day18 and day22. Further, RNA-seq was also performed in imbibed seeds matured in 16°C and 26°C, at 1 hour, 24 hours and 72 hour after imbibition.
2022-02-22 | GSE160226 | GEO
Project description:Tomato seeds (S. lycopersicum ‘Fl Lanai’) were germinated under greenhouse conditions maintained at 24°C-29°C in flat trays (BWI Apopka, Catalog Number GPPF72S7X) filled with Sungro Horticulture soil (Metro-mix 830, BWI Apopka, Cat# TX830). Two weeks post emergence seedlings were transplanted to 4” pots using the same soil and transferred to a Conviron walk-in growth chamber (CMP6060) for the remainder of the experiment. Conviron conditions include a 14h/10h light/dark cycle maintained at 28°C, and plants were fertilized weekly (20-20-20). To prevent cross contamination, tomato plants were confined to insect proof cages at all times (BioQuip 1450NS68). Four weeks after transplanting, 40 whiteflies (B. tabaci MEAM1) were collected from virus free or Tomato Mottle Virus (ToMoV) established colonies via aspiration and moved into a clip cage placed on the 4th true leaf of each tomato plant as previously described38. Whiteflies were reared cabbage (Brassica oleracea), while viruliferous whiteflies were reared on ToMoV infected tomato from colonies established in the Polston lab. For all plants in this study, feeding was halted after 3 days of whitefly feeding (3 DPI) by gentle removal of clip cages and whitefly termination using insecticidal soap (Garden Safe, 1% of potassium salts of fatty acids). For the samples referred to as “local”, the tomato leaf bound within the clip cages was immediately removed and snap frozen for protein extraction. For the samples designated “systemic”, the plants were allowed to continue growing for 7 additional days after clip cage removal and whitefly termination, at which point the 9th leaf was excised and snap frozen. Plants used for collection of local leaves at 3 DPI were not used for the collection of systemic leaves 10 DPI. For both local and systemic leaves collected, we also included a no treatment control (NTC) that was subjected identically to clip cage and insecticidal soap applications, but without the addition of whitefly or ToMoV. Our experiment therefore consists of a no-treatment control (NTC), a whitefly treatment (+WF), and a viruliferous whitefly (+WFV) treatment for both local (4th true leaf, 3 DPI) and systemic leaves (9th true leaf, 10 DPI). The presence of ToMoV in all infected plants was confirmed via Nanopore sequencing. Briefly, Tomato genomic DNA was extracted from five systemic leaf samples using the PureGene tissue DNA isolation kit (product # 158667; QIAGEN, Valencia, CA, USA), following the manufacturer’s protocol and stored at -80°C until needed. Library preparation was performed using the Rapid Sequencing Kit RBK004 protocol (Oxford Nanopore Technologies) and loaded onto a 9.4.1 flow cell in a MinION connected to a MinIT with live base calling enabled. Resulting sequencing reads for each sample were mapped to both ToMoV A component (GenBank accession: L14460) and ToMoV B component (GenBank accession: L14461) sequences.
2020-10-02 | PXD019197 | Pride
Project description:The goal of these studies is analysis of gene expression profiles in potato plants infected with potato virus Y (necrotic strain - PVYN). A prototypic plant pathogen interaction system used to study disease resistance is tobacco (Nicotiana tabacum) and tobacco mosaic virus (TMV). In tobacco, the resistance response comprises two phenomena, known as the hypersensitive response (HR) and systemic acquired resistance (SAR). HR is typically characterized by a local necrosis surrounding the site of viral entry leading to restriction of pathogen replication and spread. SAR is the enhanced ability of the plant to resist a secondary challenge by the same or a different pathogen inoculated elsewhere on the plant. The identity of the signal(s) that induces HR and SAR is still poorly understood. Plants of S. tuberosum cv. Rywal, resistant to all known (N, 0, NTN) PVY strains, were grown in growth chambers using 16 h period of light (22°C) and 8 h of darkness (18°C). For all experiments, 6-week-old plants were used. For inoculation with PVY, carborundum-dusted leaves were rubbed with water (mock control) or PVYN solution (1 µg ml-1). Two to four leaves were inoculated on each plant and harvested together at 1, 3, and 6 days post inoculation (dpi). Separately, noninoculated leaves were harvested at the same time points (upper leaves). The first time point (1 dpi) has been chosen to study the early stage of plant response before necrotic lesion formation. At 3 dpi necrotic lesions start to appear, and at 6 dpi necroses are fully developed which correlates with the maximum of salicylic acid increase in virus inoculated leaves. Keywords: Direct comparison
2008-02-13 | GSE10488 | GEO
Project description:The 35S::GFP fluorescence was silenced 6-day after infiltration to Nicotiana benthamiana leaves due to the post-transcriptional gene silencing, but became stable by adding the viral suppressor 2b which repressed RNA silencing in plants. We performed the small RNA high throughput sequencing to test whether WUS can inhibit 2b functions in repressing plant RNA silencing.
2021-02-22 | GSE128863 | GEO
Project description:AGO protein immunoprecipitation was combined with high-throughput sequencing of associated small RNAs. AGO2, AGO10, and to a lesser extent AGO1 were shown to associate with siRNAs derived from silencing suppressor (HC-Pro)-deficient TuMV-AS9, but not with siRNAs derived from wild-type TuMV. Co-immunoprecipitation and small RNA sequencing revealed that viral siRNAs broadly associated with wild-type HC-Pro during TuMV infection. These results support the hypothesis that suppression of antiviral silencing during TuMV infection, at least in part, occurs through sequestration of virus-derived siRNAs away from antiviral AGO proteins by HC-Pro. Catalytic mutant HA-AGO1-DAH, HA-AGO2-DAD and HA-AGO10-DAH or catalytically active HA-AGO10-DDH were immunoprecipitated from buffer (mock) or inoculated rosette leaves (at 7 dpi) or noninoculated cauline leaves at 10 dpi with wt TuMV or suppressor-deficient TuMV-AS9. Inflorescence from TuMV infected plants was collected at 10 dpi with wt TuMV. HC-Pro was tagged with 6xHIS in TuMV-HIS and suppressor-deficient TuMV-HIS-AS9. HC-Pro was immunoprecipitated from noninoculated cauline leaves of inflorescence at 10 dpi. HC-Pro AS9 was immunoprecipitated from noninoculated cauline leaves at 15 dpi. Total RNA was extracted from input fraction and small RNAs separated by size fractionation. Small RNAs in input and HA-AGO or HC-Pro immunoprecipitation fractions were converted to DNA Amplicons by 5' (GUUCAGAGUUCUACAGUCCGACGAUC) or 3’ (CTGTAGGCACCATCAAT) adaptor ligation followed by RT-PCR. DNA Amplicons were sequenced using the Illumina HiSeq2000 platform. Duplicate libraries were made per treatment. For each library, hits to TuMV, to TuMV-HIS and to Arabidopsis thaliana were included in separate files.
2015-04-06 | E-GEOD-64911 | biostudies-arrayexpress
Project description:rs10-01_rrm - quadruple rrm experience - What is the role of the RRM protein family in plants? Plants were grown on soil in controlled environment under LD (16 h light/8 h dark) and the rosette leaves (8-leaf stage seedlings) were collected for RNA preparation. Keywords: normal vs transgenic comparison
2011-04-16 | GSE21701 | GEO
Project description:The goal of this study was to determine protein abundance and phosphorylation changes in the FERONIA mutant (fer) in Arabidopsis leaves. Seeds were germinated on 1/2MS with constant light (24hr light) for 10 days. Then, plants were transferred to soil and grown under short day condition (8-hour light and 16-hour dark) at 22C for another 3 weeks (21 days). Samples were 4 weeks old when collected. Three biological replicates of WT as well as fer mutant rosette leaves were collected at 4 weeks. Proteins were extracted and processed into peptides using a phenol-FASP methods (https://doi.org/10.1002/pmic.201800220). Peptides were labeled with TMT6-plex reagents (WT 126, 127N, 128C; fer 129N, 130C, 131). Following TMT multiplexing phoshopeptides were enriched using Titanspere Phos-TiO 10 uM beads (GL science).
2020-01-14 | MSV000084804 | MassIVE