Targeted interference of sin3a-tgif1 function by SID decoy treatment inhibits WNT signaling and invasion in triple negative breast cancer cells
Ontology highlight
ABSTRACT:
ORGANISM(S): Homo sapiens
PROVIDER: GSE84648 | GEO | 2016/07/21
SECONDARY ACCESSION(S): PRJNA330729
REPOSITORIES: GEO
Similar Datasets
Project description:Targeted interference of sin3a-tgif1 function by SID decoy treatment inhibits WNT signaling and invasion in triple negative breast cancer cells. MDA-MB-231 cells were treated with scrambled SID control, 2.5µM SID peptide or untreated for 24h. Sub-confluent cultures of MDA-MB-231 cells were treated with scrambled SID control, 2.5µM SID peptide or untreated for 24h. Experiments were performed as three independent replicates.
2016-07-21 | E-GEOD-84648 | biostudies-arrayexpress
Project description:Cancer cell invasion is an obligatory step for metastatic dissemination that contributes to rapid relapse and a poorer survival in triple negative breast cancer (TNBC) patients. Development of novel therapeutic strategies to block tumor invasion is an unmet need in the treatment of cancer. We reported that the selective inhibition of the PAH2 domain of SIN3A protein function markedly suppressed metastatic dissemination to the lungs in TNBC xenograft bearing mice. Here, we show that TNBC cell lines treated with Sin3 interaction domain (SID) decoy peptides that bind to PAH2 display a strong in vitro inhibition of transwell invasion. This is accompanied by actin cytoskeleton reorganization with increased cortical actin deposition and downregulation of known Wnt target genes that are associated with epithelial to mesenchymal transition (EMT) and cancer cell invasion. Wnt pathway inhibition by SID decoy peptide was confirmed by decreased Wnt reporter activity and altered cytoplasmic localization of nuclear ?-catenin. TGIF1, a transcription factor that modulates Wnt signaling and known to interact with the PAH2 domain of SIN3A, can be dissociated from the SIN3A complex by SID decoys. TGIF1 knockdown inhibits WNT target genes and in vitro cell invasion suggesting that TGIF1 might be a key target of the SID decoys to block tumor invasion. Taken together, targeting SIN3 function using SID decoys is a novel strategy to reverse invasion and the EMT program in TNBC translating into the inhibition of metastasis dissemination and eradication of residual disease.
| S-EPMC5687616 | biostudies-literature
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do).
2012-08-23 | GSE39572 | GEO
Project description:Single-stranded oligos listed below (and the corresponding reverse compliment) were synthesized and annealed: E2F: CTAGATTTCCCGCGGATC (decoy); CTAGACTCTGCTCGGATC (scrambled) KTGGYRSGAA: CTAGATTCCCGCCAAGGATC (decoy); CTAGACAGCTACTCCGGATC (scrambled) TGCGCANK: CTAGACATGCGCAGGATC (decoy); CTAGATCACAGGCGGATC (scrambled) CCAATNNSNNNGCG: CTAGACGCCCTCCGATTGGGGATC (decoy); CTAGATGCACGCTCGGTCCGGATC (scrambled) ACTWSNACTNY: CTAGAGGAGTTGTAGTGGATC (decoy); CTAGAGATAGTGTGTGGGATC (scrambled) HeLa cells were propagated in DMEM (Invitrogen) plus 10% FBS and transfected with 0.5 uM of double-stranded DNA. Total RNA was extracted with TRIzol (Invitrogen) from HeLa cells 2 d after transfection of the indicated decoy oligo or scrambled oligo in duplicate. RNA was amplified using the Ambion Amino Allyl MessageAmp II aRNA kit. For each motif, decoy oligo transfected samples (labeled with Cy5) and the corresponding scrambled oligo transfected samples (labeled with Cy3) were competitively hybridized to HEEBO microarrays as described (http://www.microarray.org/sfgf/heebo.do). genetic_modification_design
2012-08-23 | E-GEOD-39572 | biostudies-arrayexpress
Project description:Triple negative breast cancer (TNBC) is characterized by a poorly differentiated phenotype and limited treatment options. Aberrant epigenetics in this subtype represent a potential therapeutic opportunity, but a better understanding of the mechanisms contributing to the TNBC pathogenesis is required. The SIN3 molecular scaffold performs a critical role in multiple cellular processes, including epigenetic regulation, and has been identified as a potential therapeutic target. Using a competitive peptide corresponding to the SIN3 interaction domain of MAD (Tat-SID), we investigated the functional consequences of selectively blocking the paired amphipathic helix (PAH2) domain of SIN3. Here, we report the identification of the SID-containing adaptor PF1 as a factor required for maintenance of the TNBC stem cell phenotype and epithelial to mesenchymal transition (EMT). Tat-SID peptide blocked the interaction between SIN3A and PF1, leading to epigenetic modulation and transcriptional downregulation of TNBC stem cell and EMT markers. Importantly, Tat-SID treatment led to a reduction in primary tumor growth and disseminated metastatic disease in vivo. In support of these findings, knockdown of PF1 expression phenocopied treatment with Tat-SID both in vitro and in vivo. These results demonstrate a critical role for a complex containing SIN3A and PF1 in TNBC and provide a rational for its therapeutic targeting. Sub-confluent cultures of MDA-MB-231 cells were treated with 1µM Tat-SID peptide or 1µM Tat-Scr scrambled control peptide for 24hr.
2015-11-02 | E-GEOD-73278 | biostudies-arrayexpress
Project description:Triple negative breast cancer (TNBC) is characterized by a poorly differentiated phenotype and limited treatment options. Aberrant epigenetics in this subtype represent a potential therapeutic opportunity, but a better understanding of the mechanisms contributing to the TNBC pathogenesis is required. The SIN3 molecular scaffold performs a critical role in multiple cellular processes, including epigenetic regulation, and has been identified as a potential therapeutic target. Using a competitive peptide corresponding to the SIN3 interaction domain of MAD (Tat-SID), we investigated the functional consequences of selectively blocking the paired amphipathic helix (PAH2) domain of SIN3. Here, we report the identification of the SID-containing adaptor PF1 as a factor required for maintenance of the TNBC stem cell phenotype and epithelial to mesenchymal transition (EMT). Tat-SID peptide blocked the interaction between SIN3A and PF1, leading to epigenetic modulation and transcriptional downregulation of TNBC stem cell and EMT markers. Importantly, Tat-SID treatment led to a reduction in primary tumor growth and disseminated metastatic disease in vivo. In support of these findings, knockdown of PF1 expression phenocopied treatment with Tat-SID both in vitro and in vivo. These results demonstrate a critical role for a complex containing SIN3A and PF1 in TNBC and provide a rational for its therapeutic targeting. Mononucleosomes from MDA-MB-231 cells were isolated and ChIP with H3K4me3 antibody. DNA from Input and ChIP samples was purified and sequenced on Illumina Hiseq.
2015-11-02 | E-GEOD-73869 | biostudies-arrayexpress
Project description:Transcriptional profiling of MDA-MB-231 comparing the regulatory consequences of transfecting synthetic decoys carring sRSM1 motifs versus synthetic scrambled oligos Two decoy/scrambled sets, each with two biological replicates
2012-02-28 | E-GEOD-35749 | biostudies-arrayexpress
Project description:Eric Hesse 9 Jan 2019, 17:34 (15 hours ago) to me, Hartmut Lieber Marcel, unten ist das abstract kopiert, reicht das? Lg, Eric Abstract Osteoporosis is caused by increased bone resorption and decreased bone formation. Intermittent administration of a fragment of Parathyroid hormone (PTH) activates osteoblast-mediated bone formation and is used in patients with severe osteoporosis. However, the mechanisms by which PTH elicits its anabolic effect are not fully elucidated. Here we show that the absence of the homeodomain protein TG-interacting factor 1 (Tgif1) impairs osteoblast differentiation and activity, leading to a reduced bone formation. Deletion of Tgif1 in osteoblasts and osteocytes decreases bone resorption due to an increased secretion of Semaphorin 3E (Sema3E), an osteoclast-inhibiting factor. Tgif1 is a PTH target gene and PTH treatment failed to increase bone formation and bone mass in Tgif1-deficient mice. Thus, our study identifies Tgif1 as a novel regulator of bone remodeling and an essential component of the PTH anabolic action. These insights contribute to a better understanding of bone metabolism and the anabolic function of PTH.
2019-01-29 | PXD012303 | Pride
Project description:Triple negative breast cancer (TNBC) is characterized by a poorly differentiated phenotype and limited treatment options. Aberrant epigenetics in this subtype represent a potential therapeutic opportunity, but a better understanding of the mechanisms contributing to the TNBC pathogenesis is required. The SIN3 molecular scaffold performs a critical role in multiple cellular processes, including epigenetic regulation, and has been identified as a potential therapeutic target. Using a competitive peptide corresponding to the SIN3 interaction domain of MAD (Tat-SID), we investigated the functional consequences of selectively blocking the paired amphipathic helix (PAH2) domain of SIN3. Here, we report the identification of the SID-containing adaptor PF1 as a factor required for maintenance of the TNBC stem cell phenotype and epithelial to mesenchymal transition (EMT). Tat-SID peptide blocked the interaction between SIN3A and PF1, leading to epigenetic modulation and transcriptional downregulation of TNBC stem cell and EMT markers. Importantly, Tat-SID treatment led to a reduction in primary tumor growth and disseminated metastatic disease in vivo. In support of these findings, knockdown of PF1 expression phenocopied treatment with Tat-SID both in vitro and in vivo. These results demonstrate a critical role for a complex containing SIN3A and PF1 in TNBC and provide a rational for its therapeutic targeting.
2015-11-02 | GSE73278 | GEO
Project description:Triple negative breast cancer (TNBC) is characterized by a poorly differentiated phenotype and limited treatment options. Aberrant epigenetics in this subtype represent a potential therapeutic opportunity, but a better understanding of the mechanisms contributing to the TNBC pathogenesis is required. The SIN3 molecular scaffold performs a critical role in multiple cellular processes, including epigenetic regulation, and has been identified as a potential therapeutic target. Using a competitive peptide corresponding to the SIN3 interaction domain of MAD (Tat-SID), we investigated the functional consequences of selectively blocking the paired amphipathic helix (PAH2) domain of SIN3. Here, we report the identification of the SID-containing adaptor PF1 as a factor required for maintenance of the TNBC stem cell phenotype and epithelial to mesenchymal transition (EMT). Tat-SID peptide blocked the interaction between SIN3A and PF1, leading to epigenetic modulation and transcriptional downregulation of TNBC stem cell and EMT markers. Importantly, Tat-SID treatment led to a reduction in primary tumor growth and disseminated metastatic disease in vivo. In support of these findings, knockdown of PF1 expression phenocopied treatment with Tat-SID both in vitro and in vivo. These results demonstrate a critical role for a complex containing SIN3A and PF1 in TNBC and provide a rational for its therapeutic targeting.
2015-11-02 | GSE73869 | GEO